ID: 936146948

View in Genome Browser
Species Human (GRCh38)
Location 2:109986649-109986671
Sequence GCTGGGCTGGGGCTGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146948_936146956 -10 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146948_936146962 6 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146948_936146967 28 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146967 2:109986700-109986722 GAGAGGAGTAAGGCGGACTTGGG No data
936146948_936146963 11 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146948_936146966 27 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146966 2:109986699-109986721 GGAGAGGAGTAAGGCGGACTTGG No data
936146948_936146965 21 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146948_936146960 3 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146948_936146964 18 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146948 Original CRISPR GCTGGGCTGGGGCTGGGCCT GGG (reversed) Intergenic
No off target data available for this crispr