ID: 936146950

View in Genome Browser
Species Human (GRCh38)
Location 2:109986655-109986677
Sequence GGTGGTGCTGGGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146950_936146968 29 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146950_936146963 5 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146950_936146965 15 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146950_936146964 12 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146950_936146962 0 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146950_936146967 22 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146967 2:109986700-109986722 GAGAGGAGTAAGGCGGACTTGGG No data
936146950_936146966 21 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146966 2:109986699-109986721 GGAGAGGAGTAAGGCGGACTTGG No data
936146950_936146960 -3 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146950 Original CRISPR GGTGGTGCTGGGCTGGGGCT GGG (reversed) Intergenic