ID: 936146951

View in Genome Browser
Species Human (GRCh38)
Location 2:109986656-109986678
Sequence AGGTGGTGCTGGGCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146951_936146968 28 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146951_936146964 11 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146951_936146965 14 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146951_936146967 21 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146967 2:109986700-109986722 GAGAGGAGTAAGGCGGACTTGGG No data
936146951_936146960 -4 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146951_936146963 4 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146951_936146962 -1 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146962 2:109986678-109986700 TGGAAGGTTCAAGTACATGGAGG No data
936146951_936146966 20 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146966 2:109986699-109986721 GGAGAGGAGTAAGGCGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146951 Original CRISPR AGGTGGTGCTGGGCTGGGGC TGG (reversed) Intergenic