ID: 936146952

View in Genome Browser
Species Human (GRCh38)
Location 2:109986658-109986680
Sequence AGCCCCAGCCCAGCACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146945_936146952 -3 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146944_936146952 2 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146946_936146952 -4 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data
936146947_936146952 -9 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146952 2:109986658-109986680 AGCCCCAGCCCAGCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146952 Original CRISPR AGCCCCAGCCCAGCACCACC TGG Intergenic
No off target data available for this crispr