ID: 936146956

View in Genome Browser
Species Human (GRCh38)
Location 2:109986662-109986684
Sequence CCAGCCCAGCACCACCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146948_936146956 -10 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146946_936146956 0 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146944_936146956 6 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146945_936146956 1 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
936146947_936146956 -5 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146956 Original CRISPR CCAGCCCAGCACCACCTGGA AGG Intergenic
No off target data available for this crispr