ID: 936146957

View in Genome Browser
Species Human (GRCh38)
Location 2:109986666-109986688
Sequence TGAACCTTCCAGGTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146957_936146969 25 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146957_936146966 10 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146966 2:109986699-109986721 GGAGAGGAGTAAGGCGGACTTGG No data
936146957_936146970 26 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data
936146957_936146964 1 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146964 2:109986690-109986712 GTACATGGAGGAGAGGAGTAAGG No data
936146957_936146967 11 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146967 2:109986700-109986722 GAGAGGAGTAAGGCGGACTTGGG No data
936146957_936146963 -6 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146957_936146968 18 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146957_936146971 27 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146971 2:109986716-109986738 ACTTGGGCGTATGGAGAAAGGGG No data
936146957_936146965 4 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146957 Original CRISPR TGAACCTTCCAGGTGGTGCT GGG (reversed) Intergenic