ID: 936146960

View in Genome Browser
Species Human (GRCh38)
Location 2:109986675-109986697
Sequence ACCTGGAAGGTTCAAGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146955_936146960 -10 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146944_936146960 19 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146951_936146960 -4 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146947_936146960 8 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146953_936146960 -8 Left 936146953 2:109986660-109986682 CCCCAGCCCAGCACCACCTGGAA No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146949_936146960 2 Left 936146949 2:109986650-109986672 CCAGGCCCAGCCCCAGCCCAGCA No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146945_936146960 14 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146948_936146960 3 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146946_936146960 13 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146954_936146960 -9 Left 936146954 2:109986661-109986683 CCCAGCCCAGCACCACCTGGAAG No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data
936146950_936146960 -3 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146960 2:109986675-109986697 ACCTGGAAGGTTCAAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146960 Original CRISPR ACCTGGAAGGTTCAAGTACA TGG Intergenic
No off target data available for this crispr