ID: 936146963

View in Genome Browser
Species Human (GRCh38)
Location 2:109986683-109986705
Sequence GGTTCAAGTACATGGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146953_936146963 0 Left 936146953 2:109986660-109986682 CCCCAGCCCAGCACCACCTGGAA No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146957_936146963 -6 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146946_936146963 21 Left 936146946 2:109986639-109986661 CCTAACCAGTCCCAGGCCCAGCC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146948_936146963 11 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146944_936146963 27 Left 936146944 2:109986633-109986655 CCGATCCCTAACCAGTCCCAGGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146954_936146963 -1 Left 936146954 2:109986661-109986683 CCCAGCCCAGCACCACCTGGAAG No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146951_936146963 4 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146949_936146963 10 Left 936146949 2:109986650-109986672 CCAGGCCCAGCCCCAGCCCAGCA No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146947_936146963 16 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146955_936146963 -2 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146950_936146963 5 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146958_936146963 -7 Left 936146958 2:109986667-109986689 CCAGCACCACCTGGAAGGTTCAA No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data
936146945_936146963 22 Left 936146945 2:109986638-109986660 CCCTAACCAGTCCCAGGCCCAGC No data
Right 936146963 2:109986683-109986705 GGTTCAAGTACATGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146963 Original CRISPR GGTTCAAGTACATGGAGGAG AGG Intergenic