ID: 936146965

View in Genome Browser
Species Human (GRCh38)
Location 2:109986693-109986715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146953_936146965 10 Left 936146953 2:109986660-109986682 CCCCAGCCCAGCACCACCTGGAA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146959_936146965 -3 Left 936146959 2:109986673-109986695 CCACCTGGAAGGTTCAAGTACAT No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146957_936146965 4 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146948_936146965 21 Left 936146948 2:109986649-109986671 CCCAGGCCCAGCCCCAGCCCAGC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146958_936146965 3 Left 936146958 2:109986667-109986689 CCAGCACCACCTGGAAGGTTCAA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146949_936146965 20 Left 936146949 2:109986650-109986672 CCAGGCCCAGCCCCAGCCCAGCA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146951_936146965 14 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146954_936146965 9 Left 936146954 2:109986661-109986683 CCCAGCCCAGCACCACCTGGAAG No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146950_936146965 15 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146961_936146965 -6 Left 936146961 2:109986676-109986698 CCTGGAAGGTTCAAGTACATGGA No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146947_936146965 26 Left 936146947 2:109986644-109986666 CCAGTCCCAGGCCCAGCCCCAGC No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data
936146955_936146965 8 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146965 2:109986693-109986715 CATGGAGGAGAGGAGTAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type