ID: 936146968

View in Genome Browser
Species Human (GRCh38)
Location 2:109986707-109986729
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146959_936146968 11 Left 936146959 2:109986673-109986695 CCACCTGGAAGGTTCAAGTACAT No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146954_936146968 23 Left 936146954 2:109986661-109986683 CCCAGCCCAGCACCACCTGGAAG No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146955_936146968 22 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146950_936146968 29 Left 936146950 2:109986655-109986677 CCCAGCCCCAGCCCAGCACCACC No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146961_936146968 8 Left 936146961 2:109986676-109986698 CCTGGAAGGTTCAAGTACATGGA No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146953_936146968 24 Left 936146953 2:109986660-109986682 CCCCAGCCCAGCACCACCTGGAA No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146951_936146968 28 Left 936146951 2:109986656-109986678 CCAGCCCCAGCCCAGCACCACCT No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146957_936146968 18 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data
936146958_936146968 17 Left 936146958 2:109986667-109986689 CCAGCACCACCTGGAAGGTTCAA No data
Right 936146968 2:109986707-109986729 GTAAGGCGGACTTGGGCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type