ID: 936146969

View in Genome Browser
Species Human (GRCh38)
Location 2:109986714-109986736
Sequence GGACTTGGGCGTATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146957_936146969 25 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146954_936146969 30 Left 936146954 2:109986661-109986683 CCCAGCCCAGCACCACCTGGAAG No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146958_936146969 24 Left 936146958 2:109986667-109986689 CCAGCACCACCTGGAAGGTTCAA No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146961_936146969 15 Left 936146961 2:109986676-109986698 CCTGGAAGGTTCAAGTACATGGA No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146959_936146969 18 Left 936146959 2:109986673-109986695 CCACCTGGAAGGTTCAAGTACAT No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data
936146955_936146969 29 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146969 2:109986714-109986736 GGACTTGGGCGTATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146969 Original CRISPR GGACTTGGGCGTATGGAGAA AGG Intergenic