ID: 936146970

View in Genome Browser
Species Human (GRCh38)
Location 2:109986715-109986737
Sequence GACTTGGGCGTATGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936146961_936146970 16 Left 936146961 2:109986676-109986698 CCTGGAAGGTTCAAGTACATGGA No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data
936146957_936146970 26 Left 936146957 2:109986666-109986688 CCCAGCACCACCTGGAAGGTTCA No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data
936146958_936146970 25 Left 936146958 2:109986667-109986689 CCAGCACCACCTGGAAGGTTCAA No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data
936146959_936146970 19 Left 936146959 2:109986673-109986695 CCACCTGGAAGGTTCAAGTACAT No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data
936146955_936146970 30 Left 936146955 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG No data
Right 936146970 2:109986715-109986737 GACTTGGGCGTATGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936146970 Original CRISPR GACTTGGGCGTATGGAGAAA GGG Intergenic