ID: 936152377

View in Genome Browser
Species Human (GRCh38)
Location 2:110028802-110028824
Sequence CCAGCAGAGAGTGCCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152370_936152377 22 Left 936152370 2:110028757-110028779 CCTGAGGGGAGGAAGGAAGCTAA No data
Right 936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152377 Original CRISPR CCAGCAGAGAGTGCCAGAGC TGG Intergenic
No off target data available for this crispr