ID: 936152768

View in Genome Browser
Species Human (GRCh38)
Location 2:110030749-110030771
Sequence TGCGAGGGCAGAAAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152768_936152784 28 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG No data
936152768_936152785 29 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152785 2:110030801-110030823 TCACACTCTCCCATGGCTGGGGG No data
936152768_936152783 27 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152768_936152781 26 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152781 2:110030798-110030820 GCCTCACACTCTCCCATGGCTGG No data
936152768_936152775 -5 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152775 2:110030767-110030789 TCGCAGCCCAGGTGGAAGTCCGG No data
936152768_936152780 22 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152780 2:110030794-110030816 CCAAGCCTCACACTCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152768 Original CRISPR TGCGAGGGCAGAAAGCCTTG GGG (reversed) Intergenic
No off target data available for this crispr