ID: 936152773

View in Genome Browser
Species Human (GRCh38)
Location 2:110030764-110030786
Sequence GACTTCCACCTGGGCTGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152773_936152784 13 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG No data
936152773_936152785 14 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152785 2:110030801-110030823 TCACACTCTCCCATGGCTGGGGG No data
936152773_936152780 7 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152780 2:110030794-110030816 CCAAGCCTCACACTCTCCCATGG No data
936152773_936152788 24 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152788 2:110030811-110030833 CCATGGCTGGGGGATGTTGTTGG No data
936152773_936152781 11 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152781 2:110030798-110030820 GCCTCACACTCTCCCATGGCTGG No data
936152773_936152783 12 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152773 Original CRISPR GACTTCCACCTGGGCTGCGA GGG (reversed) Intergenic