ID: 936152774

View in Genome Browser
Species Human (GRCh38)
Location 2:110030765-110030787
Sequence GGACTTCCACCTGGGCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152774_936152781 10 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152781 2:110030798-110030820 GCCTCACACTCTCCCATGGCTGG No data
936152774_936152785 13 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152785 2:110030801-110030823 TCACACTCTCCCATGGCTGGGGG No data
936152774_936152783 11 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152774_936152784 12 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG No data
936152774_936152780 6 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152780 2:110030794-110030816 CCAAGCCTCACACTCTCCCATGG No data
936152774_936152788 23 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152788 2:110030811-110030833 CCATGGCTGGGGGATGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152774 Original CRISPR GGACTTCCACCTGGGCTGCG AGG (reversed) Intergenic
No off target data available for this crispr