ID: 936152777

View in Genome Browser
Species Human (GRCh38)
Location 2:110030774-110030796
Sequence TGGAGAGCCGGACTTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152777_936152788 14 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152788 2:110030811-110030833 CCATGGCTGGGGGATGTTGTTGG No data
936152777_936152784 3 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG No data
936152777_936152785 4 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152785 2:110030801-110030823 TCACACTCTCCCATGGCTGGGGG No data
936152777_936152780 -3 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152780 2:110030794-110030816 CCAAGCCTCACACTCTCCCATGG No data
936152777_936152789 29 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152789 2:110030826-110030848 GTTGTTGGTCAGCTGTTAAGTGG No data
936152777_936152783 2 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152777_936152781 1 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152781 2:110030798-110030820 GCCTCACACTCTCCCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152777 Original CRISPR TGGAGAGCCGGACTTCCACC TGG (reversed) Intergenic
No off target data available for this crispr