ID: 936152778

View in Genome Browser
Species Human (GRCh38)
Location 2:110030786-110030808
Sequence GAGTGTGAGGCTTGGAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152778_936152788 2 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152788 2:110030811-110030833 CCATGGCTGGGGGATGTTGTTGG No data
936152778_936152783 -10 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152778_936152784 -9 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152784 2:110030800-110030822 CTCACACTCTCCCATGGCTGGGG No data
936152778_936152785 -8 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152785 2:110030801-110030823 TCACACTCTCCCATGGCTGGGGG No data
936152778_936152790 22 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152790 2:110030831-110030853 TGGTCAGCTGTTAAGTGGAAAGG No data
936152778_936152791 25 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152791 2:110030834-110030856 TCAGCTGTTAAGTGGAAAGGAGG No data
936152778_936152789 17 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152789 2:110030826-110030848 GTTGTTGGTCAGCTGTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152778 Original CRISPR GAGTGTGAGGCTTGGAGAGC CGG (reversed) Intergenic
No off target data available for this crispr