ID: 936152783

View in Genome Browser
Species Human (GRCh38)
Location 2:110030799-110030821
Sequence CCTCACACTCTCCCATGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936152768_936152783 27 Left 936152768 2:110030749-110030771 CCCCAAGGCTTTCTGCCCTCGCA No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152778_936152783 -10 Left 936152778 2:110030786-110030808 CCGGCTCTCCAAGCCTCACACTC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152770_936152783 25 Left 936152770 2:110030751-110030773 CCAAGGCTTTCTGCCCTCGCAGC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152777_936152783 2 Left 936152777 2:110030774-110030796 CCAGGTGGAAGTCCGGCTCTCCA No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152773_936152783 12 Left 936152773 2:110030764-110030786 CCCTCGCAGCCCAGGTGGAAGTC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152776_936152783 3 Left 936152776 2:110030773-110030795 CCCAGGTGGAAGTCCGGCTCTCC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152774_936152783 11 Left 936152774 2:110030765-110030787 CCTCGCAGCCCAGGTGGAAGTCC No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data
936152769_936152783 26 Left 936152769 2:110030750-110030772 CCCAAGGCTTTCTGCCCTCGCAG No data
Right 936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936152783 Original CRISPR CCTCACACTCTCCCATGGCT GGG Intergenic
No off target data available for this crispr