ID: 936153253

View in Genome Browser
Species Human (GRCh38)
Location 2:110033027-110033049
Sequence ACACTTCGAGGGCTCCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936153253_936153271 28 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153271 2:110033078-110033100 TCTGCGCCCCTCCTGGGCAGTGG No data
936153253_936153259 -3 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153259 2:110033047-110033069 TGTCCCCACAGCCCACCAAGGGG No data
936153253_936153264 4 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153264 2:110033054-110033076 ACAGCCCACCAAGGGGTGTCGGG No data
936153253_936153263 3 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153263 2:110033053-110033075 CACAGCCCACCAAGGGGTGTCGG No data
936153253_936153270 22 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153270 2:110033072-110033094 TCGGGGTCTGCGCCCCTCCTGGG No data
936153253_936153257 -5 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153257 2:110033045-110033067 AGTGTCCCCACAGCCCACCAAGG No data
936153253_936153258 -4 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153258 2:110033046-110033068 GTGTCCCCACAGCCCACCAAGGG No data
936153253_936153265 5 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153265 2:110033055-110033077 CAGCCCACCAAGGGGTGTCGGGG No data
936153253_936153269 21 Left 936153253 2:110033027-110033049 CCGCCAGGGAGCCCTCGAAGTGT No data
Right 936153269 2:110033071-110033093 GTCGGGGTCTGCGCCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936153253 Original CRISPR ACACTTCGAGGGCTCCCTGG CGG (reversed) Intergenic