ID: 936154464

View in Genome Browser
Species Human (GRCh38)
Location 2:110039369-110039391
Sequence CTGTAGGGGTGCCCCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936154456_936154464 23 Left 936154456 2:110039323-110039345 CCACTGACTGTAACCCAGAGTGA No data
Right 936154464 2:110039369-110039391 CTGTAGGGGTGCCCCTGACCTGG No data
936154457_936154464 10 Left 936154457 2:110039336-110039358 CCCAGAGTGATTCTCTCTTGTTC No data
Right 936154464 2:110039369-110039391 CTGTAGGGGTGCCCCTGACCTGG No data
936154458_936154464 9 Left 936154458 2:110039337-110039359 CCAGAGTGATTCTCTCTTGTTCA No data
Right 936154464 2:110039369-110039391 CTGTAGGGGTGCCCCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936154464 Original CRISPR CTGTAGGGGTGCCCCTGACC TGG Intergenic
No off target data available for this crispr