ID: 936156681

View in Genome Browser
Species Human (GRCh38)
Location 2:110051517-110051539
Sequence TGGAGGAAGTTCAGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936156681_936156688 15 Left 936156681 2:110051517-110051539 CCTGCTGTGCTGAACTTCCTCCA No data
Right 936156688 2:110051555-110051577 AGTCCCATTCACAGCCCCCAGGG No data
936156681_936156687 14 Left 936156681 2:110051517-110051539 CCTGCTGTGCTGAACTTCCTCCA No data
Right 936156687 2:110051554-110051576 AAGTCCCATTCACAGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936156681 Original CRISPR TGGAGGAAGTTCAGCACAGC AGG (reversed) Intergenic
No off target data available for this crispr