ID: 936160432

View in Genome Browser
Species Human (GRCh38)
Location 2:110080516-110080538
Sequence TGAGGTTGCAACTGAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936160432_936160439 19 Left 936160432 2:110080516-110080538 CCACAGCCTCAGTTGCAACCTCA No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936160432 Original CRISPR TGAGGTTGCAACTGAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr