ID: 936160433

View in Genome Browser
Species Human (GRCh38)
Location 2:110080522-110080544
Sequence TGGCAATGAGGTTGCAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936160433_936160439 13 Left 936160433 2:110080522-110080544 CCTCAGTTGCAACCTCATTGCCA No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936160433 Original CRISPR TGGCAATGAGGTTGCAACTG AGG (reversed) Intergenic
No off target data available for this crispr