ID: 936160435

View in Genome Browser
Species Human (GRCh38)
Location 2:110080542-110080564
Sequence GGGCAGTGGGAAAAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936160435_936160439 -7 Left 936160435 2:110080542-110080564 CCAGCCAGCTTTTCCCACTGCCC No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936160435 Original CRISPR GGGCAGTGGGAAAAGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr