ID: 936160439

View in Genome Browser
Species Human (GRCh38)
Location 2:110080558-110080580
Sequence ACTGCCCCCTCATTTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936160432_936160439 19 Left 936160432 2:110080516-110080538 CCACAGCCTCAGTTGCAACCTCA No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data
936160433_936160439 13 Left 936160433 2:110080522-110080544 CCTCAGTTGCAACCTCATTGCCA No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data
936160435_936160439 -7 Left 936160435 2:110080542-110080564 CCAGCCAGCTTTTCCCACTGCCC No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data
936160434_936160439 1 Left 936160434 2:110080534-110080556 CCTCATTGCCAGCCAGCTTTTCC No data
Right 936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936160439 Original CRISPR ACTGCCCCCTCATTTGTCCC AGG Intergenic
No off target data available for this crispr