ID: 936161028

View in Genome Browser
Species Human (GRCh38)
Location 2:110084442-110084464
Sequence AGGTGGCGCAGCGCGGTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936161017_936161028 25 Left 936161017 2:110084394-110084416 CCTCGGAGGGCCACCGGGTGCTT 0: 2
1: 0
2: 1
3: 2
4: 87
Right 936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG 0: 2
1: 0
2: 0
3: 5
4: 84
936161018_936161028 15 Left 936161018 2:110084404-110084426 CCACCGGGTGCTTAAGAGAATGT 0: 2
1: 1
2: 0
3: 1
4: 77
Right 936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG 0: 2
1: 0
2: 0
3: 5
4: 84
936161015_936161028 30 Left 936161015 2:110084389-110084411 CCAGGCCTCGGAGGGCCACCGGG 0: 2
1: 0
2: 1
3: 20
4: 194
Right 936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG 0: 2
1: 0
2: 0
3: 5
4: 84
936161019_936161028 12 Left 936161019 2:110084407-110084429 CCGGGTGCTTAAGAGAATGTGAG 0: 2
1: 0
2: 1
3: 9
4: 134
Right 936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG 0: 2
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936161028 Original CRISPR AGGTGGCGCAGCGCGGTTCC TGG Exonic
900132080 1:1091527-1091549 AGGTGCCGCAGCGCCATGCCAGG + Exonic
900178920 1:1302860-1302882 AGCCAGCGCAGCTCGGTTCCAGG + Intronic
903297090 1:22350768-22350790 AGGTGTAGCAGGGCAGTTCCAGG + Intergenic
904600754 1:31671412-31671434 AGGCAGAGCAGGGCGGTTCCAGG + Intronic
905710382 1:40097273-40097295 GGCGGGCGGAGCGCGGTTCCCGG - Exonic
905885023 1:41487129-41487151 CAGTGGAGCAGCGCTGTTCCGGG - Intergenic
907320528 1:53599395-53599417 AGGTGGCGCAGGGCATTACCTGG - Intronic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
914256203 1:145962480-145962502 AGGTGGCGGAGCCAGTTTCCTGG + Exonic
915346802 1:155201621-155201643 AGGTGGAGCAGTGCTGGTCCTGG - Intronic
920917190 1:210267268-210267290 AGGGGCTGCAGCCCGGTTCCAGG + Intergenic
922703636 1:227777309-227777331 AGGTGGCGCACAGGGGTGCCGGG + Intronic
924235760 1:241998489-241998511 AGGTGGCGCAGAGCGTGCCCCGG - Intronic
1067084377 10:43230077-43230099 AGGGGGCGCAGCGTGGGTCGGGG + Intronic
1067831732 10:49614497-49614519 GGCTGGCGGAGCGCGGTGCCGGG + Intronic
1068762921 10:60733122-60733144 AGGCGGCGCCGCGAGGCTCCGGG - Intronic
1069736826 10:70662012-70662034 AGGTGGCACAGGGCGTATCCTGG + Intergenic
1070282219 10:75058244-75058266 AGGTGGCGCAGGGCGTGGCCTGG + Intronic
1073242053 10:102065522-102065544 CGGCGGCGCGGCGCGGCTCCGGG + Exonic
1075144711 10:119873015-119873037 AGGCTGCGCAGCGCGGGGCCCGG + Intronic
1079244051 11:18740518-18740540 AGGTGGTGGAGCGTGGTGCCTGG - Intronic
1085654945 11:78305471-78305493 AGGTGGCACAGGGAGGCTCCAGG + Intronic
1089943264 11:122441229-122441251 AGGTGGGGCAGCGCGGGGGCGGG + Intergenic
1093381529 12:18500159-18500181 ACTGGGCGCAGCCCGGTTCCCGG - Intronic
1097046276 12:56189590-56189612 AGGGGGCGCAGCGCGGACCGGGG - Intergenic
1112290723 13:98142840-98142862 AGGTAGCGCCGCGCGGAGCCCGG + Intronic
1112487163 13:99830390-99830412 AGGAGGCTGAGCGTGGTTCCAGG + Intronic
1117911549 14:60642331-60642353 AGGAGGCGCAACGCGCTGCCAGG + Intergenic
1118990307 14:70791616-70791638 AGGTGGGGCAAGGAGGTTCCAGG - Intronic
1122781426 14:104145437-104145459 GGGTGGCCCAGCCCGGTGCCCGG + Intronic
1127753562 15:62068406-62068428 AGGCGGAGCCGCCCGGTTCCCGG - Exonic
1128622370 15:69161109-69161131 AGGTGGTGTAGCGGGGTTCCGGG + Intronic
1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG + Intronic
1131799279 15:96053040-96053062 ACGTGGCGCAGGGCGGATCAAGG - Intergenic
1133994836 16:10740382-10740404 GGGTGGCTCAGCTCAGTTCCAGG + Intergenic
1142072497 16:88098918-88098940 AGGGGGCGCACCGCGGGTCGGGG + Intronic
1142146579 16:88495334-88495356 AGGTGGCGGAGGCCTGTTCCAGG - Intronic
1162343525 19:10106437-10106459 AGGTGGCGCAGGTGGGGTCCCGG + Intronic
1165148503 19:33747889-33747911 AGGTGGCTCAGCGGGTCTCCTGG + Intronic
1165433272 19:35784199-35784221 GGGTGGCGCGGCGGCGTTCCGGG + Exonic
1168414510 19:56159923-56159945 AGAGGGCGCAGCGCGGGCCCGGG - Exonic
926182741 2:10660178-10660200 AGGTGCCCCAGCGCAGTTACAGG - Intronic
926423123 2:12717748-12717770 AGGGGGTGCAGCGCGGATTCTGG + Exonic
932837731 2:75052902-75052924 AGGTGGTGCAAAGCAGTTCCAGG + Intronic
934117426 2:88810695-88810717 AGGTGGAGGAGCGCGGTCCCCGG + Intergenic
935148171 2:100410319-100410341 AGGTGGCGCAGAGCGGTGCTGGG - Intronic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
939256092 2:139746766-139746788 AGGTGGAAGAGGGCGGTTCCCGG + Intergenic
1171767937 20:29300527-29300549 AGGTGGCCCCGCGCGGTACCTGG + Intergenic
1172937205 20:38628961-38628983 AGGGGGCCCAGCTCAGTTCCGGG + Exonic
1175777456 20:61662325-61662347 AGGTTGCGCTGTGCGGCTCCAGG - Intronic
1178867543 21:36342155-36342177 AGGTGGGGCAGTGCGGTTCACGG + Intronic
1183437749 22:37805124-37805146 CGGCGGCGCAGCGCCATTCCGGG + Exonic
1184886068 22:47345129-47345151 AGGTGGCCCAGCGGGGTCCATGG + Intergenic
1185349431 22:50326895-50326917 AGGTCGCGCGGCGCGGACCCCGG - Exonic
956798824 3:72738950-72738972 AGGAGGCCCTGCGCGGCTCCGGG + Intergenic
960080220 3:113533117-113533139 AGGGGTCGCGGCGCGGTGCCGGG - Exonic
963293470 3:143518255-143518277 AGGGGCTGCAGCCCGGTTCCAGG + Intronic
966806498 3:183811683-183811705 AGGTGGCGCTGCCAGGTGCCCGG + Exonic
969149623 4:5158291-5158313 CAGTGGCACAGCGCGGGTCCTGG + Intronic
969186582 4:5479011-5479033 AGGTGGTGCAAAGCGGATCCAGG + Intronic
976527905 4:86115136-86115158 AGGTGGCACAGCTCTGTGCCTGG + Intronic
977791307 4:101106866-101106888 ATGTGGCACAGCGTGGTGCCAGG - Intronic
984668075 4:182449120-182449142 GGCTGGCGGAGCGCGGCTCCCGG + Intronic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1009901452 6:69812256-69812278 AGGTGGGGCAGGGTGCTTCCAGG + Intergenic
1013010228 6:106113725-106113747 CTGTGGCCCAGCGAGGTTCCCGG - Intergenic
1013366260 6:109440637-109440659 AGGCGGGGCCGCGCGGTTGCCGG - Exonic
1016713985 6:147203699-147203721 AGGTACCGCAGCCCGGCTCCTGG + Intergenic
1019660480 7:2221161-2221183 AGGAGCCGCAGGGCGGTGCCCGG - Intronic
1020278125 7:6636988-6637010 AGGGGGCCCAGCGCGGGGCCTGG + Intergenic
1021162967 7:17298814-17298836 AGGTGCCGCCGCGCTGCTCCCGG - Exonic
1027260647 7:76462140-76462162 AGGCGGAGGGGCGCGGTTCCGGG + Intronic
1027312026 7:76960253-76960275 AGGCGGAGGGGCGCGGTTCCGGG + Intergenic
1032024630 7:128431303-128431325 GGGTGGCCCAGGGCGGTTTCCGG + Intergenic
1032504660 7:132426031-132426053 AGGTGGCACAGGGCAGTTTCTGG + Intronic
1033795021 7:144836096-144836118 AGGTGGCCCCGCCCGCTTCCGGG + Intronic
1034450240 7:151133386-151133408 AGGAGGCCCAGCGGGGCTCCAGG + Intronic
1042253022 8:66775233-66775255 TGGTGGCGCGGCGCAGGTCCCGG + Exonic
1042611654 8:70607767-70607789 AGGCTGCGCGGCGCAGTTCCTGG - Intronic
1048991485 8:139762909-139762931 AGGTGGAGCAGCGCAGTCCAGGG + Intronic
1060527000 9:124326453-124326475 AGGTGGCTCCGGGCGGCTCCTGG - Intronic
1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG + Intergenic
1061824663 9:133250598-133250620 AGGTGGAGCGGGGAGGTTCCAGG + Intronic
1062291436 9:135797022-135797044 AAGTGGAGCAGCGAGGCTCCGGG - Intergenic
1062620081 9:137416707-137416729 AGGTGGCACCAGGCGGTTCCAGG + Intronic
1189104330 X:38220817-38220839 CGGCAGCGCAGCGCGCTTCCCGG + Exonic
1191030391 X:55963390-55963412 AGGTGGCACAGGGCAGTACCAGG + Intergenic
1200951857 Y:8905286-8905308 GGGTGGGGCAGCGGGATTCCGGG + Intergenic