ID: 936161275

View in Genome Browser
Species Human (GRCh38)
Location 2:110085866-110085888
Sequence TCGCCTCCTGCGTGGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936161261_936161275 20 Left 936161261 2:110085823-110085845 CCTCAGCCCCACTGCCCAGGAGG 0: 2
1: 0
2: 8
3: 91
4: 717
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161263_936161275 14 Left 936161263 2:110085829-110085851 CCCCACTGCCCAGGAGGCCACGC 0: 2
1: 0
2: 1
3: 33
4: 286
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161266_936161275 6 Left 936161266 2:110085837-110085859 CCCAGGAGGCCACGCATGACCCT 0: 2
1: 0
2: 2
3: 13
4: 135
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161268_936161275 -3 Left 936161268 2:110085846-110085868 CCACGCATGACCCTGCCTCCTCG 0: 2
1: 0
2: 1
3: 15
4: 187
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161260_936161275 21 Left 936161260 2:110085822-110085844 CCCTCAGCCCCACTGCCCAGGAG 0: 2
1: 1
2: 7
3: 52
4: 498
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161258_936161275 30 Left 936161258 2:110085813-110085835 CCTCAGGTACCCTCAGCCCCACT 0: 2
1: 0
2: 3
3: 21
4: 359
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161264_936161275 13 Left 936161264 2:110085830-110085852 CCCACTGCCCAGGAGGCCACGCA 0: 2
1: 0
2: 2
3: 16
4: 214
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161267_936161275 5 Left 936161267 2:110085838-110085860 CCAGGAGGCCACGCATGACCCTG 0: 2
1: 0
2: 3
3: 21
4: 166
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99
936161265_936161275 12 Left 936161265 2:110085831-110085853 CCACTGCCCAGGAGGCCACGCAT 0: 2
1: 0
2: 2
3: 19
4: 205
Right 936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG 0: 2
1: 0
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936161275 Original CRISPR TCGCCTCCTGCGTGGCCTGA GGG Intronic