ID: 936162700

View in Genome Browser
Species Human (GRCh38)
Location 2:110096694-110096716
Sequence GTGTGTAGGTACATTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 2, 2: 5, 3: 49, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936162700_936162702 24 Left 936162700 2:110096694-110096716 CCAAGAAAAATGTACCTACACAC 0: 1
1: 2
2: 5
3: 49
4: 300
Right 936162702 2:110096741-110096763 ACAATTTTTGCCTACGAATCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
936162700_936162703 25 Left 936162700 2:110096694-110096716 CCAAGAAAAATGTACCTACACAC 0: 1
1: 2
2: 5
3: 49
4: 300
Right 936162703 2:110096742-110096764 CAATTTTTGCCTACGAATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 99
936162700_936162704 26 Left 936162700 2:110096694-110096716 CCAAGAAAAATGTACCTACACAC 0: 1
1: 2
2: 5
3: 49
4: 300
Right 936162704 2:110096743-110096765 AATTTTTGCCTACGAATCTGGGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936162700 Original CRISPR GTGTGTAGGTACATTTTTCT TGG (reversed) Intronic
901753740 1:11428263-11428285 GTGTATATGTGCATTTTTCAGGG + Intergenic
901864945 1:12099695-12099717 GTGTGTAAGTACACTAATCTAGG - Intronic
902183035 1:14704161-14704183 GTCTGTTGGTACAGTCTTCTAGG - Intronic
902656610 1:17873423-17873445 GTGTGGAGGTATAATTTTATAGG + Intergenic
902701802 1:18177427-18177449 GTGTGTGTGTACATGGTTCTTGG + Intronic
905868517 1:41389771-41389793 GTGTGTATGCACACTTTCCTAGG - Intergenic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
907920199 1:58904325-58904347 GTGTGGGGGGACATTTTTCTGGG + Intergenic
909033651 1:70571556-70571578 GTGTGCCAGTTCATTTTTCTGGG + Intergenic
910655370 1:89612904-89612926 GTTTGTAGGTACAATATTGTTGG + Intergenic
910779311 1:90911217-90911239 GTGTGTCTATACATTTTTCTGGG - Intergenic
911944107 1:104084186-104084208 GTGTGTATGTACACTTTTGTTGG - Intergenic
912067833 1:105767262-105767284 GAGTGGAGGTAAATTGTTCTAGG - Intergenic
912735767 1:112148272-112148294 GTGAGTGGGTGCAGTTTTCTGGG + Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
912985466 1:114424439-114424461 ATGTGTATGTTTATTTTTCTGGG + Intronic
913390484 1:118305526-118305548 ATGTGTATATACATTTTTCCTGG - Intergenic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
915064446 1:153213026-153213048 GTGTGTGGGCACTTTTTCCTTGG - Intergenic
915787791 1:158635083-158635105 GTCTGTAGTTCCATTTTTCCTGG - Intronic
916299457 1:163257695-163257717 GTGTGTTGGTATCTTTGTCTAGG - Intronic
917242775 1:172966943-172966965 GTGGGTAGGTCCCATTTTCTGGG - Intergenic
917374982 1:174342028-174342050 ATGTGTAAGTATATTTTCCTAGG + Intronic
917654956 1:177117040-177117062 GTGTCTACGTGCATTTTTCAAGG + Intronic
917762167 1:178173533-178173555 GTTCTTGGGTACATTTTTCTGGG + Intronic
917791755 1:178503637-178503659 GTGTGTATGTGCGTGTTTCTTGG - Intergenic
918767982 1:188513282-188513304 TTATGTAGGCATATTTTTCTTGG + Intergenic
918782134 1:188714077-188714099 GTGTGTAGGTAAAGTAATCTAGG + Intergenic
919324949 1:196095602-196095624 GTGTGTCATTTCATTTTTCTTGG - Intergenic
922247371 1:223813610-223813632 GTGTCTAGACAAATTTTTCTAGG - Intronic
923231273 1:231988782-231988804 GTGTGTAGGTACATTTTTATGGG - Intronic
923419453 1:233798140-233798162 GGGTGTAGGTTCAAGTTTCTTGG + Intergenic
924268507 1:242307285-242307307 GTATTTATGTGCATTTTTCTAGG - Intronic
924601673 1:245495366-245495388 ATTTGTAGGTACATATTTATAGG + Intronic
1063264925 10:4437017-4437039 GTTTGTTGGGACATTTTTATTGG + Intergenic
1063826633 10:9905986-9906008 GTATGTATGTACATTTTTGAGGG - Intergenic
1064114608 10:12567534-12567556 AGGTGTACGCACATTTTTCTAGG + Intronic
1065107149 10:22401184-22401206 GTAAGTAGGTACATTTTTGCAGG - Exonic
1065673410 10:28147162-28147184 TTGTTTAGGTCCATTTTACTTGG - Intronic
1066480557 10:35791821-35791843 GTGTGTATTTTCATTTTCCTCGG + Intergenic
1066716395 10:38291471-38291493 GTATTTATGTGCATTTTTCTAGG + Intergenic
1068316861 10:55355933-55355955 GTGTGTAGGAAAATATGTCTTGG - Intronic
1068792619 10:61043801-61043823 GTGTACATGTAGATTTTTCTGGG + Intergenic
1071426088 10:85554026-85554048 GTGTCTAGATTCATTTTTTTTGG - Intergenic
1071887989 10:89971447-89971469 GTCTGTCAGTGCATTTTTCTGGG + Intergenic
1073032675 10:100539954-100539976 GGGTGTATGTGCATTTTTATGGG + Intronic
1073189400 10:101640218-101640240 GTGGGCAGGTAGATTTTTCCTGG - Intronic
1073304315 10:102491042-102491064 GTGTGCATTTACCTTTTTCTAGG - Intronic
1073446425 10:103583301-103583323 GTGAGAATGTTCATTTTTCTGGG + Intronic
1073710831 10:106038582-106038604 GTGTGTTTTTATATTTTTCTGGG + Intergenic
1074345358 10:112679950-112679972 GTGTGTATATGCATCTTTCTGGG + Intronic
1074808119 10:117074465-117074487 GTGCTTATGTACATCTTTCTGGG + Intronic
1075813374 10:125245195-125245217 GTGTGCCTGTGCATTTTTCTGGG + Intergenic
1076283150 10:129267504-129267526 CAGTGTAGGTACATTTATATGGG + Intergenic
1078169830 11:8921165-8921187 GAGGGTATGTGCATTTTTCTAGG + Intronic
1078662192 11:13296559-13296581 GTATGTAGATACATTTTTAAAGG - Intronic
1078863542 11:15275721-15275743 TTGTGTCAGTGCATTTTTCTAGG - Intergenic
1079949163 11:26780310-26780332 ATGTGTAAATACACTTTTCTTGG - Intergenic
1080002153 11:27362572-27362594 GAGACTATGTACATTTTTCTGGG + Intronic
1080606369 11:33868664-33868686 GTGTATAGGTGAATTATTCTGGG - Intronic
1080695498 11:34600108-34600130 ATATCTAAGTACATTTTTCTAGG + Intergenic
1081062336 11:38495593-38495615 GTGTGTGTGTGCATTTTCCTGGG + Intergenic
1081831542 11:46120106-46120128 GTGTGTTGGTGCATTTGTCTTGG - Intronic
1083280456 11:61623809-61623831 CTGTGTGTGTACATTCTTCTTGG - Intergenic
1084912199 11:72399539-72399561 GTCTGTATGTACATTTTATTTGG - Intronic
1088665010 11:112085827-112085849 GCCTGTATGTGCATTTTTCTGGG - Intronic
1089528193 11:119110371-119110393 GTGTTTATATGCATTTTTCTGGG + Intronic
1090067161 11:123512858-123512880 GTATCTCTGTACATTTTTCTGGG + Intergenic
1090167277 11:124562962-124562984 GTGTGTATTTTCATTTCTCTTGG + Intergenic
1090242790 11:125195866-125195888 GTGTGCATGTACATATTCCTTGG - Intronic
1093108696 12:15122097-15122119 GTGTGTATGTATATTTTTTCAGG - Intronic
1094353176 12:29549066-29549088 CTTTGTATGTTCATTTTTCTTGG - Intronic
1094714175 12:32995204-32995226 TTCTGTAGGTACTATTTTCTTGG - Intergenic
1095330864 12:40961607-40961629 ACGTGTATGTACATTTTCCTGGG + Intronic
1095739471 12:45591459-45591481 GTGTACATGTGCATTTTTCTAGG + Intergenic
1096322073 12:50623376-50623398 GTGTGTAGATACATATATTTTGG - Intronic
1096418380 12:51433518-51433540 GTGTGAATGTGCACTTTTCTTGG - Intronic
1097403118 12:59153936-59153958 GTGCATAAGAACATTTTTCTGGG + Intergenic
1097559349 12:61183040-61183062 GTTGGTAGGAACAGTTTTCTGGG + Intergenic
1097705810 12:62867055-62867077 GCTTTTTGGTACATTTTTCTGGG - Intronic
1098734558 12:74082370-74082392 GTGTGTATTTAAAATTTTCTGGG + Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1101541497 12:105669628-105669650 GTGTGTATGTACACATTTCTGGG + Intergenic
1102020409 12:109678413-109678435 GGATGTATGTGCATTTTTCTAGG + Intergenic
1102732076 12:115120516-115120538 ATGTGTTTGTACATTTTTATTGG + Intergenic
1103539405 12:121655398-121655420 GTGTTTATGTTCATTTTTCTGGG - Intronic
1103718379 12:122959853-122959875 GTGTGGACGTACATTTCACTCGG - Exonic
1104080256 12:125423961-125423983 GTGTGTATTTGCATTTTTCTGGG - Intronic
1108026647 13:46184949-46184971 GTGTGTATGTACTTTTTTTCTGG + Intronic
1108539246 13:51422347-51422369 GTGTGCATGAACTTTTTTCTGGG - Intronic
1109358052 13:61258103-61258125 GTGTGTAATTTCATTTTTTTTGG + Intergenic
1110379529 13:74834541-74834563 GTATGTAGGCACATTATTTTGGG - Intergenic
1110593502 13:77292394-77292416 GTGTGTGTGTTCAGTTTTCTTGG - Intronic
1110973387 13:81796443-81796465 GTGTGTAGCTTTATTATTCTGGG - Intergenic
1112167263 13:96932723-96932745 ATGTGTAGGTACATTGTTCTTGG + Intergenic
1112298914 13:98212685-98212707 GAGAGTAGGGTCATTTTTCTTGG - Intronic
1112540812 13:100310822-100310844 TTGTATAGGTAGATTTTTCCAGG + Intronic
1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG + Intronic
1112674980 13:101690816-101690838 GTGTATTGGTATATTTTTCCAGG + Intronic
1112948709 13:104962754-104962776 GTGTGTAGGGACAGTCTTGTAGG - Intergenic
1113362822 13:109646849-109646871 GTGTGTAACTGTATTTTTCTAGG + Intergenic
1114211436 14:20618825-20618847 GTGTGTTTGTTCATTCTTCTAGG + Intergenic
1114515856 14:23300088-23300110 GTGGGTAGGTACATCTCTGTTGG - Intronic
1114589733 14:23850485-23850507 GTGTGTATGTATATATGTCTAGG + Intergenic
1115322876 14:32104041-32104063 TTGTGCATGTGCATTTTTCTAGG - Intronic
1115725709 14:36214005-36214027 GTGAGTAGCTAAATTCTTCTGGG + Intergenic
1116172236 14:41417664-41417686 GTGTGTAAGTACAGCTTTATTGG + Intergenic
1117741263 14:58821549-58821571 GTCTGTAGGTAATTTTTTCAAGG + Intergenic
1118804893 14:69227479-69227501 TTTTGTATGTACATTTTTCTAGG + Intronic
1119735272 14:76977621-76977643 GTGTGGAGGAAGATTTTCCTAGG + Intergenic
1120842580 14:89098692-89098714 GTGTGCATGCACATATTTCTTGG + Intergenic
1121421108 14:93815196-93815218 GTTTTTAGGTACAGTTTTCTAGG - Intergenic
1122391763 14:101394038-101394060 CTTTGTAGGTATATTTTGCTGGG + Intergenic
1122767300 14:104081344-104081366 GTGTGTAAACACAGTTTTCTTGG - Intergenic
1123986336 15:25649621-25649643 GTGTATATGTACATTTTCCGAGG + Intergenic
1124421595 15:29527725-29527747 GTGTGTGTGTTTATTTTTCTGGG - Intronic
1125155613 15:36581207-36581229 GGGAATAGGTAGATTTTTCTGGG + Intronic
1126124095 15:45279675-45279697 ATGTGTATGGACATCTTTCTAGG + Intergenic
1126326748 15:47486715-47486737 CTGAGTACGTACATTTTTATAGG + Intronic
1126535176 15:49753828-49753850 GTTTGTATTTGCATTTTTCTAGG - Intergenic
1126580940 15:50242153-50242175 ATGTGTACATGCATTTTTCTTGG - Exonic
1129262554 15:74376803-74376825 GTGTGTGAGAACATCTTTCTGGG + Intergenic
1129819116 15:78584645-78584667 GTGTGTGTGCACATTTTTCTAGG + Intronic
1129953013 15:79608523-79608545 GTTTGCAGATACATTTTGCTTGG + Intergenic
1130737580 15:86566282-86566304 TTGAGTATGCACATTTTTCTAGG + Intronic
1131366026 15:91840895-91840917 GTGTGTAGGCACATCCTACTAGG - Intergenic
1131405505 15:92160962-92160984 ATGGGTAGGTGCATTTTGCTGGG + Intronic
1133332618 16:4984821-4984843 TTGTGTTGGTATATTTTCCTTGG + Intronic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134391826 16:13826966-13826988 ATTTTTAGTTACATTTTTCTTGG - Intergenic
1134529510 16:14972199-14972221 GTGAGTGAGTGCATTTTTCTGGG - Intergenic
1134914316 16:18057097-18057119 GCATGTAGGCACATTTTTCTGGG - Intergenic
1137413127 16:48246042-48246064 GTGACTATGTACATTTTTTTAGG + Intronic
1137596918 16:49730175-49730197 GTGTGTAAGACCAGTTTTCTAGG - Intronic
1138013673 16:53409641-53409663 GTGTCTAGGTTCATTTTTTAGGG - Intergenic
1139866844 16:70068761-70068783 GTGAGTGGGTGCATTTTTCTGGG + Intergenic
1139939591 16:70595628-70595650 TTTTGTAGGAACATTCTTCTGGG + Intronic
1140673356 16:77301355-77301377 TTGTGTAGGCACATTTTGGTTGG - Intronic
1142378719 16:89720416-89720438 GTGCGTTCGTGCATTTTTCTGGG - Intronic
1144061609 17:11587878-11587900 GTATGAAGGTACATTTTCCATGG + Intergenic
1144097700 17:11916844-11916866 GTGGGTATGTGCATTTTTCGGGG - Intronic
1144107554 17:11999274-11999296 ATGTGTATGTGCATTTTTCTTGG - Intergenic
1148112236 17:45151741-45151763 ACTTGTATGTACATTTTTCTGGG + Exonic
1150071061 17:62150260-62150282 TTGTGTTCGTGCATTTTTCTGGG + Intergenic
1152043405 17:77919819-77919841 CCCTGTAGGGACATTTTTCTTGG + Intergenic
1152888902 17:82868739-82868761 ATTTCTAGGTGCATTTTTCTGGG + Intronic
1153218637 18:2843473-2843495 GTGTTTAGGGACAGTTCTCTTGG - Intergenic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156090125 18:33456905-33456927 GTGTGTGTGTACAGCTTTCTGGG - Intergenic
1156155002 18:34291259-34291281 ATCTGCAGGTACATTATTCTTGG - Intergenic
1156254584 18:35383025-35383047 GTGCATATGTGCATTTTTCTTGG + Intergenic
1156879239 18:42056557-42056579 AGGTGTAGATACATTTTCCTTGG - Intronic
1157001872 18:43536752-43536774 GTATGGAGGTACATTTGTGTTGG + Intergenic
1157140120 18:45097121-45097143 GCATGTAATTACATTTTTCTTGG - Intergenic
1157399416 18:47374790-47374812 ATGTTTATGTACATTCTTCTGGG + Intergenic
1157590787 18:48835498-48835520 GTGCAGAGGTGCATTTTTCTGGG + Intronic
1157629803 18:49083178-49083200 GTTTGTAAGTACAGTTTTCTTGG - Intronic
1158282896 18:55847288-55847310 GTGTGTAAGTAAATTCATCTTGG - Intergenic
1158654685 18:59320337-59320359 GTGTGTAGGATCTTTTTTTTTGG + Intergenic
1159018684 18:63124740-63124762 GTGTGTAACCACATTTGTCTGGG + Exonic
1159913912 18:74172185-74172207 GTGTTTATGTTCCTTTTTCTTGG + Intergenic
1161514031 19:4686726-4686748 GTATGTAGGTAAATTTTGGTGGG + Intronic
1161882639 19:6967456-6967478 GTGTATAGGTACATTTGTCTGGG + Intergenic
1163181925 19:15610102-15610124 ATGTGTTGGTGCATCTTTCTGGG - Intergenic
1163946612 19:20542101-20542123 GGGTGTAGGTACAATATTGTAGG - Intronic
1163970791 19:20792491-20792513 GTGTGTGTGTATATTTTTCAGGG + Exonic
1166013577 19:39962322-39962344 ATGTGTGGCTACATTTTTTTTGG + Intergenic
1166102804 19:40581114-40581136 GTATGTGGGTGGATTTTTCTAGG - Intronic
1166126651 19:40718772-40718794 ATTTGTATGTACATTTTTCTAGG + Intronic
926512076 2:13794018-13794040 GATTGAAGGCACATTTTTCTGGG + Intergenic
927725580 2:25419943-25419965 GTGTTTAGGTACATTTATCGAGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929067353 2:37991680-37991702 GTGTCTAGGTACACTATTCACGG + Intronic
929077523 2:38090772-38090794 GTATTTAGGTACATTCTACTTGG - Intronic
930719395 2:54624782-54624804 GTGTGTATTTTCATTTTTGTAGG + Exonic
932789480 2:74641476-74641498 TTGGTTAGATACATTTTTCTAGG - Intronic
933029855 2:77314235-77314257 TACTGTAGGTACATTTTTCTTGG + Intronic
934119245 2:88824196-88824218 GTGTATAGGTACATTTTTCTTGG - Intergenic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
936619974 2:114085338-114085360 TTGTGTACTTACATTTTTCTAGG + Intergenic
937016404 2:118610071-118610093 GTGCATAAGTTCATTTTTCTAGG + Intergenic
937187416 2:120057429-120057451 ATGTGTATGTGCATTTTTCTAGG - Intronic
937944571 2:127320640-127320662 GTGTCTAGGTATATTTGTGTAGG - Intronic
939053452 2:137333432-137333454 GTGTGTCTGTACCTTTTTCCAGG + Intronic
939853623 2:147330376-147330398 GAGTGGAAGTAAATTTTTCTCGG - Intergenic
939913702 2:148014433-148014455 TTAAGAAGGTACATTTTTCTAGG - Intronic
940205636 2:151198648-151198670 GTGTGAAGGTACACTTCCCTGGG - Intergenic
940713923 2:157196683-157196705 GTGTGAAGTTTCATTCTTCTTGG + Intergenic
941300918 2:163800104-163800126 AAGTGTAGGTACACTCTTCTAGG + Intergenic
941503089 2:166305906-166305928 GTGTTTAGGTACACTTTTACTGG - Exonic
941839584 2:170066445-170066467 TTGTGTATGTGCATTTTTATTGG + Intronic
945036697 2:205709682-205709704 GTGAGTAGGCACATTTTTCTAGG - Intronic
947220362 2:227785931-227785953 ATGTATAGCTATATTTTTCTTGG - Intergenic
948406280 2:237722334-237722356 GTGTGCACTTACATTTTCCTGGG + Intronic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1169872331 20:10261305-10261327 GTGTGTAGGTACCTTTATCCTGG - Intronic
1170606832 20:17881024-17881046 GTGTGTAGATACATATATATAGG + Intergenic
1171085211 20:22232400-22232422 ATGTGTACTTATATTTTTCTAGG - Intergenic
1171479667 20:25444460-25444482 GTGTTTTTTTACATTTTTCTTGG + Intronic
1177962860 21:27690374-27690396 GTGTATAGATACGTTTTTCAAGG - Intergenic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1184350758 22:43942268-43942290 ATCTGTAGCTTCATTTTTCTTGG + Intronic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
950030688 3:9851099-9851121 GTGTGTAAGTCCATTATTCAAGG - Intronic
950257270 3:11515780-11515802 GAGTGTAGGTACAGTTTAATGGG + Intronic
950860861 3:16146249-16146271 ATCTCCAGGTACATTTTTCTGGG + Intergenic
951286740 3:20822497-20822519 GTGTGTAGGTACACTGTGTTTGG + Intergenic
953102590 3:39844215-39844237 TGATGTAGGTCCATTTTTCTAGG + Intronic
953724860 3:45388895-45388917 GTGTATATGTGCATTTTTCTGGG - Intronic
955070165 3:55566264-55566286 GTGTGTAAAAACATTTTTCATGG - Intronic
955520584 3:59771873-59771895 GTGTGTGCACACATTTTTCTAGG - Intronic
956437546 3:69248228-69248250 GTGTGTATTTACATTTTTCTAGG - Intronic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
957239781 3:77643548-77643570 GTTTGTAGTTAGATTTTTTTGGG + Intronic
957271306 3:78033624-78033646 GTGTATGGTTACATTTTTCAGGG - Intergenic
959320222 3:104864073-104864095 GTGTTTAGGTGCATTTTTGGGGG - Intergenic
960202247 3:114850861-114850883 GTGGATAGGCACACTTTTCTGGG + Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
962393256 3:134991924-134991946 GTGTGTGGTTACACTTTTCCAGG + Intronic
962535930 3:136328662-136328684 GTGTGTGGGTGCAAATTTCTTGG - Intronic
964448450 3:156785579-156785601 ATGTGTATATGCATTTTTCTGGG + Intergenic
964641917 3:158917569-158917591 GTATATGTGTACATTTTTCTAGG + Intergenic
965186097 3:165466371-165466393 TTGTGGAGGTACATTTCACTGGG - Intergenic
966608807 3:181848027-181848049 GTGTACATGTGCATTTTTCTGGG + Intergenic
967197824 3:187044033-187044055 GTGTGTCCGTGCATTTTTCCAGG + Intronic
968231063 3:197004868-197004890 GGGTGGATGTGCATTTTTCTGGG - Intronic
970000642 4:11362724-11362746 ATATGTAGGTCCATTTTTATAGG - Intergenic
972202979 4:36737682-36737704 TTGTGAAGATAAATTTTTCTAGG + Intergenic
973146199 4:46830380-46830402 GTATGTAGGAAAACTTTTCTAGG + Intronic
975018729 4:69460026-69460048 ATGTATAGTTACATATTTCTGGG + Intergenic
975788543 4:77921873-77921895 GTGCATGTGTACATTTTTCTTGG + Intronic
975925503 4:79446128-79446150 ATGTGTAGGTACATTTATTGCGG + Intergenic
976165423 4:82249303-82249325 GTGTGTGAGTATATTTATCTTGG - Intergenic
977777749 4:100941472-100941494 GTGCTTAGCTACCTTTTTCTAGG + Intergenic
978215470 4:106196155-106196177 GTGTGTATGTATATATTTCTAGG - Intronic
978396480 4:108285944-108285966 GTGTATGAGCACATTTTTCTAGG + Intergenic
978431633 4:108639402-108639424 GTGTGCACGTGCATTTTTCTAGG + Intergenic
980030241 4:127819949-127819971 GTGTGTATTTTCATTTTTCTTGG + Intronic
980150930 4:129048057-129048079 ATGTTTCAGTACATTTTTCTGGG - Intronic
980856473 4:138446672-138446694 GTTTGTAGGTATGTTGTTCTTGG - Intergenic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981166383 4:141563546-141563568 GATTGTAGGTCCATTTTTCTTGG + Intergenic
981452306 4:144912380-144912402 ATGTGTATGTATGTTTTTCTGGG - Intergenic
981836484 4:149060520-149060542 GTGTGTGGGCAAATTTTTTTTGG - Intergenic
982976791 4:162073254-162073276 GTGTGTATGTATATTTTTATGGG + Intronic
983176470 4:164594402-164594424 GTGTATACTAACATTTTTCTAGG + Intergenic
983287460 4:165757733-165757755 GTGTGTCTCTACATTTTCCTTGG - Intergenic
984000973 4:174244198-174244220 ATGTGTATGTGCATTATTCTGGG - Intronic
984179165 4:176460525-176460547 GTGTCTAGGTTCATTTTTTCTGG - Intergenic
985045687 4:185938369-185938391 GTATGTGTCTACATTTTTCTGGG - Intronic
986765771 5:10924625-10924647 GTGTGTGCGAACATTTTGCTGGG + Intergenic
987576637 5:19736687-19736709 GTGTGGGGGTGCTTTTTTCTTGG + Intronic
988462440 5:31452210-31452232 GTGCACAGGGACATTTTTCTGGG - Intronic
989051441 5:37324234-37324256 GTGTGTAGGTATACTTTATTCGG - Intronic
990201421 5:53380090-53380112 GTGTGTATTTTCATTTTTGTTGG - Intergenic
990266087 5:54077433-54077455 GTGTCTGCGTTCATTTTTCTGGG - Intronic
991132753 5:63143471-63143493 GTGTTAAGGTTCATTTTTTTTGG + Intergenic
992984069 5:82209525-82209547 GTGTGTTGGTACCTTGATCTTGG + Intronic
993268173 5:85756005-85756027 GTGTATGTGTACATTTGTCTTGG + Intergenic
993543579 5:89182922-89182944 GTTTGTTGGTACATTTTCTTGGG + Intergenic
995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG + Intergenic
996577439 5:124991238-124991260 GTTTATATGTACATTTTTTTGGG + Intergenic
998365537 5:141628378-141628400 ATGTGTATGTGCATTTTTCTGGG - Intronic
999501470 5:152150893-152150915 GTGTGTAGTTACAAATTCCTTGG - Intergenic
999979489 5:156944317-156944339 GTGTGCACACACATTTTTCTGGG - Intronic
1004499806 6:16198959-16198981 GTGTTTGTATACATTTTTCTGGG + Intergenic
1006581039 6:35078249-35078271 GAGTGTGTGTGCATTTTTCTGGG - Intronic
1008002076 6:46371060-46371082 GTATGTATGTACATTTTTCGAGG + Intronic
1008330990 6:50244243-50244265 GTGTGTGTGTATATATTTCTAGG + Intergenic
1008337136 6:50321284-50321306 GTGTTGAGGGAGATTTTTCTGGG - Intergenic
1009650246 6:66467006-66467028 GTGTGTGGGGACGTTTTTATGGG + Intergenic
1009837481 6:69021883-69021905 GTGTGCATGTACATTTTTATAGG + Intronic
1013695627 6:112699565-112699587 GTGAGTAGCTACATTTTTAGAGG - Intergenic
1014440732 6:121470964-121470986 GTGTGTATATAAATTTTTCCTGG - Intergenic
1014673672 6:124338526-124338548 TTGATTAGGTATATTTTTCTAGG + Intronic
1015353343 6:132248350-132248372 ATGTGCACCTACATTTTTCTGGG + Intergenic
1015526309 6:134177492-134177514 GTGTGCAGGTTGATGTTTCTGGG - Intronic
1016189668 6:141248749-141248771 ATGAGTTGGTACCTTTTTCTTGG + Intergenic
1016318782 6:142819324-142819346 GTGTCTATGTGCATTTTCCTGGG + Intronic
1016688431 6:146907741-146907763 GTGTGGAGGTCCAATTGTCTAGG - Intergenic
1018269713 6:162063914-162063936 GTGTGTATTTTCATTTTTCTTGG - Intronic
1018286324 6:162242480-162242502 GTACTTAGGTACATTTTACTTGG - Intronic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1022299425 7:29089426-29089448 GACTGTAGGTACACTTTGCTTGG - Intronic
1024299124 7:47872818-47872840 GTGTGTGGTTTCATTTTCCTTGG - Intronic
1027955932 7:84879983-84880005 GTGTGTAGGTACCTGATTATTGG - Intergenic
1028633840 7:92965192-92965214 GTATGTAGTTTCTTTTTTCTGGG + Intergenic
1028755996 7:94434931-94434953 GTGGGTATGTGCATTTTTCTTGG + Intergenic
1029130729 7:98328714-98328736 GTGTGTGGGCACATTTTTGTTGG - Intronic
1029840564 7:103358738-103358760 AAATCTAGGTACATTTTTCTAGG + Intronic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1030806009 7:113920040-113920062 GTGTGCAGTTAAATTTTTATAGG - Intronic
1032754519 7:134876122-134876144 GTGCATATGTGCATTTTTCTTGG - Intronic
1033400008 7:141013996-141014018 GTGTGTGTGTAAATTGTTCTGGG + Intronic
1034080246 7:148270299-148270321 GTATGCAGCAACATTTTTCTTGG - Intronic
1035959202 8:4118166-4118188 GTGTGTTGGTACATTTATGCTGG + Intronic
1037186965 8:16076320-16076342 ATGTGTATGTATATTTTTATTGG + Intergenic
1037706584 8:21320724-21320746 GTATGTTTGTACATTTTCCTGGG - Intergenic
1038553139 8:28486939-28486961 GCGTGTATGTGCATTTTTCTAGG - Intronic
1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG + Exonic
1041036183 8:53793056-53793078 ATGTGTAGGAACTCTTTTCTAGG - Intronic
1043488004 8:80717958-80717980 GTGCAAAGGTGCATTTTTCTAGG + Intronic
1043647728 8:82542528-82542550 ATGTGTAGGCACATTTTCCTGGG + Intergenic
1044446459 8:92282574-92282596 GTGTGTAAGTAAAATTTTCTTGG + Intergenic
1044902520 8:96962656-96962678 GTGCATTGGTATATTTTTCTGGG + Intronic
1045292931 8:100849261-100849283 GTGTGCATGTACAATTTTCTGGG - Intergenic
1045437598 8:102179755-102179777 TTGTGTTGGTACAGTATTCTGGG - Intergenic
1046069674 8:109235169-109235191 GTCAGTAGATACATTTTTCTAGG + Intergenic
1046354426 8:113061247-113061269 ATGTGTAGCTACAATTTTCAGGG - Intronic
1047773848 8:128052504-128052526 TTGTGAAGGTATATTTTTCATGG + Intergenic
1047999053 8:130361864-130361886 GTGTGTGCGCACATTTTTCCTGG - Intronic
1049525586 8:143125156-143125178 GTGTGTGTGTACATTTATCAGGG - Intergenic
1050894508 9:10870441-10870463 GTGTATGGGTGCATTTTTCTAGG - Intergenic
1051069150 9:13141956-13141978 GTGTGTTTGTTCATTTTTATTGG - Intronic
1051220171 9:14840296-14840318 CTATGTACGTACATTTTGCTAGG - Intronic
1051375247 9:16395769-16395791 ATGTGTAAGTACATTTTCCTTGG - Intergenic
1052745403 9:32435406-32435428 GTGGGTATGTGCATTTTTCTGGG - Intronic
1055309688 9:74965322-74965344 TTGTGTCCTTACATTTTTCTCGG - Intergenic
1055321043 9:75083732-75083754 CTGGCTAGGTACATTTTTTTTGG + Intronic
1056026223 9:82497869-82497891 GTATGTGAATACATTTTTCTAGG + Intergenic
1056768303 9:89458954-89458976 GTGTGTAGGCACATGTGTGTAGG - Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057168683 9:92947790-92947812 CTGTGTGGGCTCATTTTTCTGGG + Intronic
1057215071 9:93223472-93223494 GTGTGTAGTTGCATATTTATTGG + Intronic
1057644699 9:96862035-96862057 GTGTATATGTACATTTTCTTTGG - Intronic
1059532012 9:115043848-115043870 TGGTGTAGGTACATTTTAGTAGG + Intronic
1059628498 9:116093332-116093354 CTGTGTAGGAACATTGTTTTAGG - Intergenic
1059908452 9:119015566-119015588 TTGTCTATGTACATTTTTGTTGG - Intergenic
1059921215 9:119162008-119162030 ATATGAAGGTACATTTTTATTGG + Intronic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1061050871 9:128194025-128194047 CTGTGTTGGTTCATCTTTCTGGG + Intronic
1185988492 X:4864388-4864410 GTGTGTATATACATATTTCTAGG - Intergenic
1186091888 X:6057869-6057891 GTGTGTAGGTAAATTGCTTTGGG - Intronic
1186491054 X:9972665-9972687 GTGTGTATGGACATTCTTCTGGG - Intergenic
1187065751 X:15836156-15836178 GTGTCTCAGTACATTTTTGTTGG + Intronic
1187292893 X:17972428-17972450 GTCTATAGGTGCATTTTTCTGGG + Intergenic
1188366360 X:29320236-29320258 GTGCATATGTACATTTTTATGGG + Intronic
1188942686 X:36260547-36260569 GTGTTTAGCTACATTTTTAATGG + Intronic
1189237604 X:39499767-39499789 GTGTATATGTACATTTTCTTTGG + Intergenic
1189724046 X:43950860-43950882 GTGCTTATGTACATTTTTCTGGG - Intronic
1191756323 X:64596461-64596483 ATGTATAGGTACAATTTTCCAGG + Intergenic
1191892638 X:65960483-65960505 GTGAGTAGGTACATTTTGGGTGG + Intergenic
1192586969 X:72326776-72326798 GTACATATGTACATTTTTCTGGG - Intergenic
1193545028 X:82816061-82816083 GTCTGTATGGACATTTTTCTAGG + Intergenic
1193690274 X:84633602-84633624 GTTTCTAGGTACATTTTTTGGGG - Intergenic
1193801222 X:85938630-85938652 GTGCATAGCTACATTTTTCTAGG - Intronic
1194296831 X:92136483-92136505 ATGTGAAGTAACATTTTTCTTGG - Intronic
1194564428 X:95466774-95466796 GTATGTAGGTAAATAATTCTAGG + Intergenic
1195675048 X:107501695-107501717 GTGCGTATGTACACTTTTCTGGG + Intergenic
1196322049 X:114352761-114352783 GTGTGTGTATGCATTTTTCTGGG + Intergenic
1196526265 X:116730700-116730722 TTTTGAAGGTACACTTTTCTAGG - Intergenic
1196870235 X:120106538-120106560 GTGGTGAGGTACATTCTTCTTGG + Intergenic
1197261396 X:124322748-124322770 GAGTTTAGGTACATTCTCCTTGG + Intronic
1198302690 X:135346819-135346841 ATGTGTATGTGTATTTTTCTAGG + Intronic
1198573251 X:137981193-137981215 GTGAGTCTCTACATTTTTCTTGG - Intergenic
1200327758 X:155260476-155260498 GTCTGTAGGTATGTTTTCCTGGG + Exonic
1200614345 Y:5361060-5361082 ATGTGAAGTAACATTTTTCTTGG - Intronic