ID: 936166606

View in Genome Browser
Species Human (GRCh38)
Location 2:110125957-110125979
Sequence CTGTGGTTGTATAGTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936166606 Original CRISPR CTGTGGTTGTATAGTTTTCA TGG (reversed) Intronic
902847038 1:19119563-19119585 CTCTGTTTGTGGAGTTTTCAGGG + Exonic
903469687 1:23577402-23577424 ATGTGTGTGTATTGTTTTCAGGG - Intergenic
906023015 1:42647772-42647794 ATGTGTTTGTGTAGTTTCCAAGG - Intronic
906542192 1:46595754-46595776 CTGTCGTTGGATGGTGTTCAAGG - Intronic
907084761 1:51661136-51661158 ATGTGGTTGTAGAGTTATAATGG + Intronic
908822464 1:68102528-68102550 CTGGGGTTGTATCATTTTGAAGG + Intronic
909365466 1:74815457-74815479 CTGTGGTTATAAAGTCTTAAGGG - Intergenic
910323709 1:85979037-85979059 ATGTGTTTGTATGGTTTTGAGGG - Intronic
910619647 1:89238774-89238796 CAGTAGTTGTATAGACTTCACGG - Intergenic
911679061 1:100692880-100692902 ATGTATTTGTATAGTTTTGAGGG + Intergenic
911700847 1:100950113-100950135 CAGTGGTTCTTTAGTTTTAATGG + Intronic
912601396 1:110937427-110937449 ATGTATTTGTATAGTTTTCAAGG - Intergenic
913429241 1:118771633-118771655 ATGTATTTGTATAGTTTTGAGGG - Intergenic
913463976 1:119119758-119119780 ATGTATTTGTATAGTTTTGAGGG - Intronic
913828204 1:123193965-123193987 CTGTGTTTGTAAAGTCTGCACGG + Intergenic
914217614 1:145647246-145647268 CTGTGTTTGGAAAATTTTCATGG + Exonic
914470180 1:147969938-147969960 CTGTGTTTGGAAAATTTTCATGG + Exonic
916364399 1:164008206-164008228 CTTTGGCTGTATAGTATTCCAGG - Intergenic
916903005 1:169250766-169250788 ATGTATTTGTATAGTTTTGAGGG + Intronic
917155579 1:171994995-171995017 CTGTGGTGTTTTTGTTTTCAAGG + Intronic
919095962 1:193036852-193036874 ATGTGTTTGTGTAGTTTCCAAGG - Intronic
920384326 1:205557700-205557722 ATGTATTTGTATAGTTTCCAGGG - Intergenic
921843121 1:219849670-219849692 ATGTATTTGTATAGTTTTGAGGG - Intronic
923723468 1:236486899-236486921 CTGTGGTTGTTTAGTGTTGGTGG + Intergenic
924871931 1:248056647-248056669 CTGTAGTTGTGTGGTTTTGAGGG + Intronic
1062962748 10:1585727-1585749 GTTTGGTTTTATAGATTTCAGGG - Intronic
1063078105 10:2736596-2736618 CTGGGACTGTATTGTTTTCAGGG + Intergenic
1063328401 10:5129128-5129150 ATGTATTTGTATAGTTTTGAGGG - Intronic
1065202686 10:23330040-23330062 CTGGGTTTGAATACTTTTCATGG - Intronic
1065782481 10:29182971-29182993 TTGTGGCTGCATAGTATTCATGG + Intergenic
1065789763 10:29250055-29250077 CTGTGGTTGTCTGTTTTGCATGG - Intergenic
1067974534 10:51009012-51009034 TTGTGGTTCTCTTGTTTTCATGG + Intronic
1068011151 10:51453600-51453622 ATGTATTTGTATAGTTTTGAGGG + Intronic
1068122623 10:52798949-52798971 ATGTATTTGCATAGTTTTCAGGG + Intergenic
1068713503 10:60159766-60159788 ATGTGTTTGCATAGTTTCCAAGG - Intronic
1069171598 10:65237345-65237367 CTGAGGTAGTACAGTTTACAAGG - Intergenic
1070400837 10:76052395-76052417 CTGTGGTTGTAAGGTGTTCCTGG + Intronic
1072664565 10:97384280-97384302 CTGAGGTTGTGGAGTTCTCAGGG - Intronic
1072777364 10:98212296-98212318 CTTTAGTTGGAAAGTTTTCAAGG - Intronic
1072820898 10:98556625-98556647 ATAAGGTTTTATAGTTTTCAAGG - Intronic
1072875627 10:99170017-99170039 CTGTTTTTGTATAGTTTTATTGG - Intronic
1073390133 10:103168642-103168664 TTATGGTTGTTTAGTTTTCTGGG - Intronic
1074297985 10:112208938-112208960 CAGTGGTTGTTTAGCATTCATGG - Intronic
1074570376 10:114618869-114618891 CTGTGGTCGTGTGGTTTTCATGG + Intronic
1074588510 10:114790488-114790510 CTTTGGCTATATAATTTTCAAGG + Intergenic
1075157865 10:119994710-119994732 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1076106185 10:127825547-127825569 CTTTGGTTTTATACATTTCAGGG - Intergenic
1077930554 11:6727529-6727551 ATGTGTTTGTATAGTTTCCAAGG - Intergenic
1077964109 11:7109290-7109312 ATGTATTTGTATAGTTTTGATGG + Intergenic
1078036911 11:7815392-7815414 CTATGGCTGTATAGTATTCCAGG - Intergenic
1078883372 11:15475629-15475651 CTGAGATTGTAGATTTTTCAGGG + Intergenic
1079762898 11:24353845-24353867 CTGAGGTTGTAAAGTTTGTAAGG + Intergenic
1079973983 11:27070057-27070079 ATGGGTTTGTATTGTTTTCAGGG + Intronic
1083537490 11:63483456-63483478 TTGTATTTGTATAGTTTTGAGGG - Intronic
1086053165 11:82617918-82617940 CTTTGGTTTTACAGTTTTCAGGG - Intergenic
1086819185 11:91413789-91413811 ATGTGTTTGTATAGTTTTGAGGG - Intergenic
1087731714 11:101785745-101785767 ATGTATTTGTATAGTTTTAAGGG + Intronic
1087823603 11:102739695-102739717 ATGTGTTTGTATAGTTTCTAAGG + Intergenic
1088180757 11:107106819-107106841 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1088413284 11:109560414-109560436 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088413565 11:109564647-109564669 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088525744 11:110752114-110752136 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1088526545 11:110762324-110762346 ATGTGTTGTTATAGTTTTCAAGG + Intergenic
1088800308 11:113299834-113299856 CTGTATTTGTATAGTTTTGAGGG - Intergenic
1091091323 11:132773777-132773799 CTCTGGCTGTATAATTTTTATGG + Intronic
1092602895 12:10086034-10086056 ATGTATTTGTGTAGTTTTCAGGG - Intronic
1093202415 12:16204879-16204901 CTATGGTTGTATAATTTTAATGG - Intronic
1093468758 12:19478759-19478781 ATGTGTTTGTGTAGTTTTGAGGG + Intronic
1093512197 12:19942613-19942635 TGCTGGTTGCATAGTTTTCAAGG - Intergenic
1093899781 12:24618444-24618466 CTGTGGGGGTAAAATTTTCATGG - Intergenic
1094259813 12:28480729-28480751 ATGTGGTTGTTTAATTTTCTGGG - Intronic
1095226036 12:39677789-39677811 ATGTATTTGTACAGTTTTCAGGG - Intronic
1096444351 12:51675377-51675399 CTGTGGCTTTACAGTTTTCCAGG - Intronic
1096897356 12:54836874-54836896 ATGTATTTGTATAGTTTTGAGGG + Intronic
1098292025 12:68965547-68965569 GTTTGGTTGTATACATTTCAAGG - Intronic
1098295747 12:69002299-69002321 CTGTGTTTGTACTGATTTCATGG - Intergenic
1098417370 12:70250707-70250729 ATGTGGTTGAATGGTTTTCCAGG + Intronic
1098499833 12:71178552-71178574 ATGTATTTGTATAGTTTTGAGGG - Intronic
1099067030 12:77993815-77993837 CTGTGCATGCACAGTTTTCAAGG - Intronic
1099361010 12:81701775-81701797 CTTTATTTGTATAGTTTTAATGG - Intronic
1099382575 12:81973228-81973250 ATGTGTTTGTATGGTTTTGAAGG - Intergenic
1099633647 12:85183017-85183039 CTTTGGTTACATAGTTTTAATGG + Intronic
1104741686 12:131180588-131180610 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1105689110 13:22817944-22817966 CTGTGATTAAATAGTTTTAATGG - Intergenic
1107253081 13:38389646-38389668 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1108344230 13:49529218-49529240 CTGTGAATGTTAAGTTTTCAGGG - Intergenic
1108769194 13:53677528-53677550 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
1108914237 13:55588392-55588414 TTCAGGTTGTATACTTTTCATGG - Intergenic
1109001930 13:56815654-56815676 ATGTATTTGTATAGTTTTTAGGG - Intergenic
1109596863 13:64567819-64567841 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1110387630 13:74932456-74932478 CGGAGGTTGTATACTTTGCAGGG + Intergenic
1110946135 13:81420707-81420729 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1111036613 13:82682585-82682607 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1111198603 13:84905376-84905398 CACTGGTTGTAGAGTTTGCATGG + Intergenic
1111394855 13:87651965-87651987 TTGTGGCTGCATAGTATTCATGG + Intergenic
1113946298 13:114045742-114045764 CTGTTTTTGTGTAATTTTCATGG - Intronic
1114230039 14:20773083-20773105 GTTTGGTTGTATAGTTTTTAGGG - Intergenic
1114698431 14:24650059-24650081 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1115242611 14:31264685-31264707 TTGTGGTTGTATGTTTTTCAGGG + Intergenic
1115256767 14:31411374-31411396 CTGTGCATTTGTAGTTTTCATGG - Intronic
1115371589 14:32621467-32621489 ATGTGTTTGTATAATTTTAAGGG + Intronic
1116030609 14:39567054-39567076 CTATGGTTGTATAGTTTTGATGG + Intergenic
1117193207 14:53314010-53314032 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1119547322 14:75481756-75481778 CTTTGGTTGTATAGTTCTATGGG - Intergenic
1120854357 14:89200039-89200061 CTGTGCTTGGATAATTTTTAGGG + Intronic
1121435905 14:93919209-93919231 ATGTGTTTGTTGAGTTTTCATGG + Intronic
1122239272 14:100351349-100351371 CCGTGTTAGTATAATTTTCATGG - Intronic
1122513243 14:102286951-102286973 GTGTGTGTGTATAGTTTTTAAGG - Intronic
1125438972 15:39680634-39680656 CTGTGGTTCTACAGTTACCAAGG - Intronic
1125549579 15:40535505-40535527 CTATAGATTTATAGTTTTCAGGG + Intronic
1126504320 15:49386350-49386372 ATGTATTTGTATAGTTTTGAGGG - Intronic
1128669040 15:69560614-69560636 CTGTGGTTATCTATTTTTCTAGG - Intergenic
1131419906 15:92296539-92296561 CAGTGGTTGAATAGTTTGGAAGG + Intergenic
1133418869 16:5628466-5628488 CTGTGTTTGTTTAGGTTTCTAGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139024161 16:62793373-62793395 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1139817952 16:69691900-69691922 CTGGGTTTGAATAGTTGTCAGGG - Exonic
1140179506 16:72700509-72700531 CAGTGAGTTTATAGTTTTCATGG + Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1144541727 17:16148970-16148992 TTGTGGTTATATAATTTTCATGG - Intronic
1148400350 17:47354170-47354192 CTGTATTTGCATAGTTTTGAGGG + Intronic
1149953215 17:61014948-61014970 ATGTTGTTTTGTAGTTTTCAGGG - Intronic
1150192194 17:63254926-63254948 CTGTGGTTTTCTTGTTTTCATGG + Intronic
1152255543 17:79237298-79237320 CTGCGGTCGTTTAGTTTGCATGG + Intronic
1153268954 18:3299758-3299780 ATGTATTTGTATAGTTTTGAAGG - Intergenic
1153379846 18:4426067-4426089 CTGTGTTTTTATAGTGTTCTGGG - Intronic
1153425327 18:4956563-4956585 ATGTACTTGTATAGTTTTGAGGG - Intergenic
1155490905 18:26401028-26401050 CTGTATTTGTATTGTTTTCTTGG + Intergenic
1156160610 18:34353892-34353914 TAGTGGTTTTATAGTTTTTAAGG - Intergenic
1157507736 18:48241553-48241575 ATGTCTTTGTATAGTTTTGAGGG - Intronic
1158112892 18:53961480-53961502 CTGTGATTGTGTAATTTCCATGG + Intergenic
1159977812 18:74737715-74737737 CTTTAGTTGTATATTTTTAAAGG + Intronic
1163970791 19:20792491-20792513 GTGTGTGTGTATATTTTTCAGGG + Exonic
1164026059 19:21354312-21354334 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1164102762 19:22072788-22072810 CTGTGTTTGTGTGTTTTTCAGGG + Exonic
1164134673 19:22403511-22403533 GTGTGTTTGTATGTTTTTCAGGG - Exonic
1164164141 19:22653286-22653308 GTGTGTTTGTATGTTTTTCAGGG + Exonic
1164309626 19:24034343-24034365 CTGTGGATGTATAGATTTTCAGG - Intronic
925351546 2:3204308-3204330 CTGTGAGTGTGAAGTTTTCAGGG - Intronic
926072732 2:9912838-9912860 CTGTGGCTGTATGGTCTACAAGG + Intronic
926104987 2:10144433-10144455 CTGTGGTTCTAGAGATTTCTGGG + Intronic
926617733 2:15014479-15014501 ATGTGTTTGTGTAGTTTCCAAGG - Intergenic
926664534 2:15506224-15506246 CTGTTTCTGTAAAGTTTTCATGG - Intronic
926866761 2:17368292-17368314 ATGTATTTGTATAGTTTTAAGGG + Intergenic
926990400 2:18673707-18673729 ATGTATTTGTACAGTTTTCAGGG + Intergenic
928019574 2:27692290-27692312 ATGTATTTGTATAGTTTTGAAGG + Intronic
928959548 2:36909649-36909671 CTATGGGTTTATAGTTTTCATGG - Intronic
930537287 2:52659202-52659224 TAGTAGTTTTATAGTTTTCAGGG - Intergenic
930928488 2:56850825-56850847 CTGAGGTTGGATGGTTTTCCAGG + Intergenic
930943153 2:57037973-57037995 ATGTGTTTGCATAGTTTCCAAGG + Intergenic
933340749 2:81023149-81023171 ATATAGTTGTATAGTTTTGAGGG + Intergenic
934111131 2:88744297-88744319 ATGTATTTGTATAGTTTTGAGGG + Intronic
936166606 2:110125957-110125979 CTGTGGTTGTATAGTTTTCATGG - Intronic
937410905 2:121674242-121674264 CTGTATTTGTATAGTTTTGAGGG - Intergenic
937716101 2:125035103-125035125 ATGTATTTGTATAGTTTTGAGGG + Intergenic
938212161 2:129477501-129477523 CTGTGGTTGTGAATTTATCAAGG + Intergenic
938919602 2:135982888-135982910 CTTTGGTTCCTTAGTTTTCAAGG + Intronic
939557849 2:143698414-143698436 ATGTGGCTTTATAGTTTTGAGGG - Intronic
940544578 2:155067143-155067165 ATGTATTTGTATAGTTTTGAGGG + Intergenic
940630547 2:156232558-156232580 ATGTGTCTGTATAGTTTTGAGGG - Intergenic
942607361 2:177706945-177706967 CTTTGGTTTTATAATTTTTATGG + Intronic
943127966 2:183819919-183819941 ATGTACTTGTATAGTTTTGAGGG + Intergenic
943423787 2:187703338-187703360 TTGTATTTGTATAGTTTTGAGGG - Intergenic
943447002 2:187998907-187998929 ATGTATTTGTATAGTTTTGATGG - Intergenic
943514812 2:188871335-188871357 CTTTGGTTGTCTATATTTCATGG - Intergenic
945997264 2:216448255-216448277 CTGATGCTATATAGTTTTCATGG + Intronic
947737270 2:232462331-232462353 GTGTGGCTGGAAAGTTTTCATGG + Intergenic
948746547 2:240099049-240099071 ATGTATTTGTATAGTTTTGAGGG - Intergenic
949002542 2:241624645-241624667 CTGTAGTTCTGAAGTTTTCATGG + Intronic
1170865607 20:20153070-20153092 ATGTATTTGTATAGTTTTGAGGG - Intronic
1171513126 20:25703985-25704007 ATGTAGTTGTGTAGTTTTGAGGG + Intergenic
1172899386 20:38323180-38323202 CTGTGTTTTTATACTTTTTATGG + Intronic
1173117159 20:40255591-40255613 CTGTGCTTTTAAAGTTTTCATGG + Intergenic
1174547360 20:51335542-51335564 CTACGGATGTATAGATTTCAGGG + Intergenic
1175512449 20:59540417-59540439 ATGTGTTTGTATATTTTTCAAGG + Intergenic
1176658388 21:9610405-9610427 ATGTATTTGTATAGTTTTGATGG + Intergenic
1177281909 21:18991774-18991796 CTGTTGTTGTTTATTTTTCAGGG + Intergenic
1177610850 21:23446068-23446090 CTTTTCTTGTATAGTTTTGAAGG - Intergenic
1177657557 21:24038643-24038665 CTTTGGTTGTCTTATTTTCAAGG - Intergenic
1179318081 21:40263408-40263430 ATGTATTTGTATAGTTTTGAGGG - Intronic
1180040115 21:45272751-45272773 ATGTGTTTGTATAGTTTTGAGGG - Intronic
1180896611 22:19339151-19339173 ATGTATTTGTATAGTTTTGAGGG - Intronic
1181332588 22:22105298-22105320 ATGTATTTGTATAGTTTTAAGGG - Intergenic
1182134147 22:27884903-27884925 CTTTATTTGTATAATTTTCAAGG - Intronic
1182994789 22:34802033-34802055 CTGTGCTTGTAAAGTTTTATTGG - Intergenic
1183035421 22:35137487-35137509 CTGTGGTGGTAAAGTCTTGAAGG - Intergenic
949682230 3:6527507-6527529 CTGTTCTTGTATAGTCCTCAAGG - Intergenic
949725436 3:7039193-7039215 CTGTGATTGTGGAGTTTGCATGG + Intronic
950309152 3:11940695-11940717 CTTTGCTTGTATACTTTTAAAGG - Intergenic
950588122 3:13911542-13911564 ATGTATTTGTATAGTTTTGAGGG - Intergenic
950594014 3:13962871-13962893 ATGTATTTGTATAGTTTTGAGGG + Intronic
951260433 3:20501526-20501548 ATGTATTTATATAGTTTTCAGGG + Intergenic
951290705 3:20868540-20868562 CTGTGATTGTACAGTTTTGGAGG + Intergenic
951572244 3:24076707-24076729 ATGTAGTTGCATAGTTTTGAAGG + Intergenic
951702574 3:25511070-25511092 CTGTGTTTGTAAAGTTTTATTGG - Intronic
952243469 3:31559493-31559515 ATGTATTTGTACAGTTTTCAAGG + Intronic
952984615 3:38767531-38767553 ATGTATTTGTATAGTTTTGAGGG + Intronic
952993942 3:38858870-38858892 ATGTATTTGTATAGTTTTGAAGG - Intronic
953195942 3:40733185-40733207 ATGTATTTGTATAGTTTTGAGGG + Intergenic
954017954 3:47711781-47711803 CTGTGTAACTATAGTTTTCAAGG - Intronic
954495453 3:50955484-50955506 TTATGGCTGTATAGTATTCATGG - Intronic
955722798 3:61901514-61901536 CTTTGGATTTATAGTTTCCAAGG - Intronic
956244364 3:67165124-67165146 ATGTATTTGTATAGTTTTGAAGG + Intergenic
957270306 3:78022172-78022194 TTGTAGTTTTATAGGTTTCAGGG - Intergenic
957395359 3:79629349-79629371 ATGTATTTGTATAGTTTTGAGGG - Intronic
957572708 3:81968941-81968963 CTGTGGCTTTATATTTTTAATGG + Intergenic
958509878 3:95034510-95034532 CTGAATTTGTATAGTTTTGAGGG + Intergenic
960332445 3:116378260-116378282 CTGTTGTGGTATTTTTTTCAAGG + Intronic
960468428 3:118028343-118028365 ATGTATTTGTATAGTTTTGAGGG + Intergenic
960558112 3:119051826-119051848 ATGTATCTGTATAGTTTTCAGGG - Intronic
960929731 3:122834412-122834434 GTGTGTTTGTACAGTTTTGAGGG - Intronic
962120838 3:132558263-132558285 TTGTGGTTTTACAGATTTCAAGG + Exonic
962566369 3:136664595-136664617 CTGTGGTTCTAAACTTTTCATGG - Intronic
962861946 3:139412013-139412035 ATGTATTTGTATAGTTTTGAGGG + Intergenic
963023364 3:140894647-140894669 ATGTGTTTTTATAGTTTTGAGGG + Intergenic
963050861 3:141142334-141142356 ATGTATTTGTATAGTTTTGATGG + Intronic
963677044 3:148325524-148325546 TTATGGCTGTATAGTATTCATGG - Intergenic
964474424 3:157085789-157085811 GTGTTATCGTATAGTTTTCATGG + Intergenic
964565113 3:158041485-158041507 ATGTATTTGTATAGTTTTGAGGG - Intergenic
964935458 3:162079720-162079742 TTTTGGTTGTATATTTTTAATGG + Intergenic
965345391 3:167542485-167542507 ATGTATTTGTATAGTTTTGAGGG - Intronic
965452426 3:168854722-168854744 ATGTGTTTGTATAGTTTCCAAGG + Intergenic
965782965 3:172307342-172307364 CTGTGTCTGTTTTGTTTTCAGGG + Exonic
966031934 3:175360256-175360278 CTCTACTTGTTTAGTTTTCAAGG + Intronic
966121467 3:176526173-176526195 CAGTGCTTGAAGAGTTTTCAGGG + Intergenic
966319996 3:178691569-178691591 ATGAGGTTGTATCCTTTTCAGGG - Intronic
967236341 3:187387507-187387529 ATGTATTTGTATAGTTTTGAGGG - Intergenic
967958462 3:194898495-194898517 ATGTATTTGTATAGTTTTGAGGG + Intergenic
969930071 4:10622268-10622290 TTGTGGTCATATAGTTTTAAAGG + Intronic
971061975 4:22981986-22982008 ATGTATTTGTATAGTTTTAAGGG - Intergenic
971239187 4:24872471-24872493 CTGTGGGTGCATAATATTCAGGG - Intronic
971770560 4:30890638-30890660 GTTTGTTTTTATAGTTTTCAGGG + Intronic
971957001 4:33433687-33433709 CTATGTTTGTATATTTTTTAGGG - Intergenic
972018380 4:34275667-34275689 CTGTGGTTTTTTAGTTTACTTGG + Intergenic
973920373 4:55678289-55678311 ATGTGTTTGCATGGTTTTCAGGG - Intergenic
975346416 4:73297274-73297296 ATGTGTTTGTGTAGTTTCCAAGG - Intergenic
976015682 4:80551097-80551119 CTTTAGTTGAACAGTTTTCATGG - Intronic
976359454 4:84160472-84160494 CTGAGGTTGGAGAGTTTGCATGG + Intergenic
976562554 4:86518907-86518929 ATGTATTTGTATAGTTTTGAGGG + Intronic
976869793 4:89777306-89777328 ATGTATTTGTATAGTTTTGAGGG - Intronic
977432890 4:96954526-96954548 TTGTAGTTGTATGGTTTTCATGG + Intergenic
979103007 4:116646418-116646440 GTGTGTTTGTGTAGTTTCCAAGG - Intergenic
979790524 4:124775215-124775237 ATGTATTTGTATAGTTTTTAAGG + Intergenic
979954607 4:126936401-126936423 CAATGGTTTTATATTTTTCAAGG - Intergenic
980279104 4:130694855-130694877 CTGTGGCTGTATAGATTTTAAGG - Intergenic
981923564 4:150114036-150114058 GTGTATTTGTATAGTTTTGAGGG + Intronic
982095018 4:151913541-151913563 TTATGGTTGCATAGTTTCCATGG + Intergenic
983980659 4:173991865-173991887 CTGTTGTTGTATATTTTGAAAGG - Intergenic
984247759 4:177296044-177296066 CTGTTGTTCAAGAGTTTTCATGG + Intergenic
984376232 4:178933988-178934010 CTGTGTTTCTGTGGTTTTCATGG + Intergenic
985417025 4:189745671-189745693 ATGTATTTGTATAGTTTTGATGG - Intergenic
985659289 5:1148043-1148065 GTTTGGTTGTATACATTTCAGGG - Intergenic
987752387 5:22057767-22057789 GAGTGTTTGCATAGTTTTCATGG + Intronic
988889745 5:35602063-35602085 ATGTATTTGTATAGTTTTGAGGG - Intergenic
989025728 5:37065421-37065443 CTTTTCTTGTATTGTTTTCAGGG - Exonic
989200473 5:38757909-38757931 CTGTGGTTCTATGGGTTTCTAGG + Intergenic
989460612 5:41694030-41694052 ATGTATTTGTATAGTTTTGAGGG + Intergenic
990523357 5:56601248-56601270 ATGTGGTTTCTTAGTTTTCAAGG + Intronic
990628528 5:57641557-57641579 TTGTGGTGTTCTAGTTTTCAAGG + Intergenic
992142109 5:73808868-73808890 CTGTCTTGGTATAGTTTTCTTGG + Intronic
992404042 5:76439144-76439166 ATGTATTTGTATAGTTTTGAAGG + Intronic
993053608 5:82954350-82954372 TTGTAGTTATATAATTTTCAAGG - Intergenic
993365780 5:87032504-87032526 ATGTATTTGTATAGTTTTAAGGG + Intergenic
993606952 5:90002898-90002920 ATGTTTTTGTATAGTTTTGAGGG - Intergenic
994363944 5:98889845-98889867 CTGTGGCTGTGTAGTATTCATGG - Intronic
994636299 5:102348203-102348225 ATGTGTTTGTATTGTTTTGAGGG - Intergenic
994887582 5:105584170-105584192 ATGTGTTTGTAGAGTTTTGAGGG - Intergenic
995593792 5:113727531-113727553 ATGTAGTTGTATGGTTTTGAGGG + Intergenic
995606223 5:113858531-113858553 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG + Intergenic
996074617 5:119176387-119176409 CTCTGGTTGTATATTTCCCAAGG + Intronic
996213678 5:120842057-120842079 CTGTAGCTGTATATTTTTCAAGG - Intergenic
996326774 5:122284077-122284099 ATGTATTTGTATGGTTTTCAGGG + Intergenic
996427252 5:123327912-123327934 ATGTATTTGTATAGTTTTGAGGG + Intergenic
997175835 5:131776594-131776616 CTGTGTTTGGCTTGTTTTCAAGG - Intronic
997701678 5:135906281-135906303 CTGAGGTAGAAGAGTTTTCATGG - Intergenic
998708630 5:144794912-144794934 ATGTATTTGTATAGTTTTAAGGG + Intergenic
998741858 5:145212559-145212581 ATGTATTTGTATAGTTTTGAGGG - Intergenic
999568743 5:152894782-152894804 CTGTGATTTTACAATTTTCATGG - Intergenic
1000394877 5:160763410-160763432 ATGTATTTGTATAGTTTTGAAGG - Intronic
1000498052 5:162010595-162010617 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1001166058 5:169368659-169368681 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1001667130 5:173442647-173442669 CTCTGGTTGTGTAATTTTAATGG - Intergenic
1002768780 6:269154-269176 CTGTGGTTATAGTGTTTTCTGGG + Intergenic
1005259237 6:24040143-24040165 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1005435385 6:25805250-25805272 ATGTATTTGGATAGTTTTCATGG - Intronic
1005634144 6:27737450-27737472 CTGTGTTTGAAAAATTTTCATGG - Intergenic
1005766786 6:29019156-29019178 ATGTGTTTGTATAGTTTCCAAGG + Intergenic
1006286500 6:33099322-33099344 ATGTATTTGTATAGTTTTGAAGG - Intergenic
1007526395 6:42498350-42498372 GTGTATTTGTATAGTTTTGAGGG + Intergenic
1008765425 6:54907343-54907365 TTGTGGTTGTTTATTTTCCACGG - Intronic
1008793818 6:55275195-55275217 CTGTGGTAATACATTTTTCAGGG + Intronic
1008853170 6:56049455-56049477 TGGTGTTTGTATGGTTTTCATGG - Intergenic
1010358356 6:74963081-74963103 ATGTGTTTGTATAGTTTTTAGGG + Intergenic
1010637444 6:78278935-78278957 ATGTCTTTGTATAGTTTTGAGGG + Intergenic
1010976132 6:82315748-82315770 ATGCATTTGTATAGTTTTCAGGG - Intergenic
1011240980 6:85271104-85271126 CTGTGGATGTATAAATTTCTGGG + Intergenic
1011717526 6:90122975-90122997 CTGTTGTTGAATAGTTTAGAAGG + Intronic
1011933920 6:92751191-92751213 ATGTATTTGTACAGTTTTCAAGG + Intergenic
1012273337 6:97241897-97241919 ACGTATTTGTATAGTTTTCAAGG + Intronic
1012978350 6:105803899-105803921 CTCAGCTTGTATTGTTTTCATGG + Intergenic
1013046150 6:106488129-106488151 CTGTGGTGGTATGGTTTTGCAGG + Intergenic
1014278379 6:119414029-119414051 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1014367112 6:120558010-120558032 ATATGATTGTGTAGTTTTCAGGG - Intergenic
1014421248 6:121248167-121248189 ATGTATTTGTATAGTTTTGAGGG - Intronic
1018022991 6:159779897-159779919 TGCTGGTTGCATAGTTTTCAAGG + Exonic
1018540847 6:164877658-164877680 GTGTGATTGTATAGTGATCACGG + Intergenic
1019600123 7:1877644-1877666 CTGTGTCTGTATATTTTTAATGG - Intronic
1021178439 7:17477357-17477379 CTATGGATGAATAGTTTTGAAGG + Intergenic
1023441043 7:40185423-40185445 CTGTTGTGGTTTAGTTTCCATGG - Intronic
1023498936 7:40827834-40827856 CTGTGGCTGGATGGTTTCCATGG - Intronic
1024164596 7:46718153-46718175 TTGTGTTTGTATATTTTTGAGGG + Intronic
1024485765 7:49917367-49917389 CTTTGGCTGAATACTTTTCAGGG - Exonic
1024822237 7:53345800-53345822 CTCTTTTTGTAAAGTTTTCATGG + Intergenic
1024893527 7:54229949-54229971 CTGTATATGTATAGTTTTGAGGG - Intergenic
1024900391 7:54312438-54312460 CTGTATATGTATAGTTTTGAGGG + Intergenic
1025040267 7:55636978-55637000 ATGTGTTTGTGTAGTTTCCAAGG + Intergenic
1026442856 7:70459045-70459067 CTGTGGTTGTGTGGTTTCCCCGG + Intronic
1027353833 7:77337820-77337842 CTGTGGTTGAATAGTTTTAATGG + Intronic
1027508009 7:79042931-79042953 CCATGATTGTATAGTTTTGAGGG - Intronic
1028819284 7:95187796-95187818 CTGTATTTGTTTAGTTTTGAGGG + Intronic
1032468349 7:132160937-132160959 GTTTGGTTTTATAGATTTCAGGG - Intronic
1032915746 7:136487697-136487719 CCCTAGTTGTATTGTTTTCATGG - Intergenic
1033499415 7:141932977-141932999 CAGTGGTTTCATAGTTTTCCTGG - Intronic
1037478691 8:19283563-19283585 ATATGTTTGTATAGTTTTGAGGG + Intergenic
1037790643 8:21937477-21937499 CTGTGCTTGTCTAGTTTCCTAGG + Intronic
1039253626 8:35694038-35694060 ATGTGTTTGTTTAGTTTTCTTGG - Intronic
1039726767 8:40226336-40226358 CCATGGTTGTCTAGTTTTCCTGG + Intergenic
1042476228 8:69251094-69251116 CTGTGGTAATATAGATTTCATGG - Intergenic
1044056393 8:87575233-87575255 CTGTTGTTGTTTATTTTTTAAGG - Intronic
1045797971 8:106067896-106067918 ATGTGGTTGTGCAGTTTTGAGGG - Intergenic
1047466963 8:125126072-125126094 CTGCCCTTTTATAGTTTTCAAGG - Intronic
1048803945 8:138221887-138221909 TTGTGGTTTTATATTTTTCAGGG - Intronic
1050124790 9:2345354-2345376 ATGTGGTTGTTTACTGTTCAGGG + Intergenic
1050476052 9:6042158-6042180 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1050708993 9:8438314-8438336 TTGTGGTGGTTTAGTTTTTATGG + Intronic
1053107104 9:35419538-35419560 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1053259971 9:36654040-36654062 CTGTTGTTGGAGAGTTTTAATGG + Intronic
1054844570 9:69779972-69779994 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1054965734 9:71025352-71025374 CTGTTGTTATATAGACTTCAGGG - Intronic
1055139434 9:72859227-72859249 CAGAGGTTGTATGGATTTCAAGG + Intergenic
1056623076 9:88231184-88231206 CTGAGACTGTATAGTCTTCATGG + Intergenic
1057340255 9:94194564-94194586 GTGTATTTGTATAGTTTTGAGGG + Intergenic
1057462988 9:95282782-95282804 ATGTATTTGTAAAGTTTTCAAGG - Intronic
1058275973 9:103041674-103041696 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1203454110 Un_GL000219v1:148995-149017 CAGAGGTTGAACAGTTTTCAGGG + Intergenic
1203636119 Un_KI270750v1:113980-114002 ATGTATTTGTATAGTTTTGATGG + Intergenic
1185716191 X:2344460-2344482 CTGTGGTCGTATAGTATTTCTGG - Intronic
1186606006 X:11092437-11092459 CTGTGGTTTTATTGCTTTGAAGG + Intergenic
1186703162 X:12113153-12113175 CTGTGCTGGTCTAATTTTCAGGG - Intergenic
1188590444 X:31827766-31827788 ATGTGTTTGTATAGTTTTGAGGG - Intronic
1188678678 X:32975037-32975059 CAGTGGTTGTGTAAGTTTCAAGG - Intronic
1189639086 X:43048318-43048340 ATGTATTTGTATAGTTTTGAAGG + Intergenic
1189851326 X:45178985-45179007 CTTTGTTTGTGTAGTTTTCTTGG - Intronic
1190485583 X:50920823-50920845 ATGTGGTTATATAGTTGTCCTGG + Intergenic
1192885398 X:75332104-75332126 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1192904081 X:75531413-75531435 ATGTATTTGTATAGTTTTCAGGG + Intergenic
1193255603 X:79345049-79345071 CCGTATTTGTATAGTTTTGAGGG - Intergenic
1193415482 X:81217544-81217566 ATGTATTTGTATAGTTTTGAGGG + Intronic
1193723372 X:85013613-85013635 ATGTATTTGTATAGTTTTGAGGG + Intronic
1193966634 X:87995647-87995669 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194001543 X:88435519-88435541 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194103401 X:89736131-89736153 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1194543976 X:95208709-95208731 CTGTGGATCTATAGTTTCCCTGG - Intergenic
1194934739 X:99935361-99935383 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1196590245 X:117478931-117478953 TTTTGGTTGTATACTTTTCCTGG + Intergenic
1196621189 X:117826270-117826292 ATGTATTTGTATAGTTTTAAGGG + Intergenic
1197433175 X:126391796-126391818 CTATGGCTGCATAGTATTCATGG - Intergenic
1197565085 X:128073751-128073773 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1197604109 X:128564375-128564397 ATGTATTTGTATAGTTTTGAGGG - Intergenic
1198411114 X:136369453-136369475 CTGGAGTTGTATAGTTTTTAAGG - Intronic
1199209801 X:145194625-145194647 CTGTGGTTGTGTAGCATTGAAGG - Intergenic
1199564555 X:149200707-149200729 ATGTATTTGTATAGTTTTGAGGG + Intergenic
1199660639 X:150046878-150046900 TTGTAGTTCTCTAGTTTTCAGGG + Intergenic
1199976765 X:152898823-152898845 CTGTGGCTGGATTGTTTTGATGG + Intergenic
1200988994 Y:9332102-9332124 TTGTGGTTTTAAATTTTTCAAGG - Intergenic