ID: 936166902

View in Genome Browser
Species Human (GRCh38)
Location 2:110128698-110128720
Sequence ATGGTTTAGCCTAATACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936166902_936166907 16 Left 936166902 2:110128698-110128720 CCTGATGTATTAGGCTAAACCAT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 936166907 2:110128737-110128759 GGCCAAAAATGGCTGAAAATTGG 0: 1
1: 0
2: 3
3: 21
4: 218
936166902_936166905 5 Left 936166902 2:110128698-110128720 CCTGATGTATTAGGCTAAACCAT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 936166905 2:110128726-110128748 ACTGCCACTTAGGCCAAAAATGG 0: 1
1: 0
2: 0
3: 10
4: 125
936166902_936166903 -5 Left 936166902 2:110128698-110128720 CCTGATGTATTAGGCTAAACCAT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 936166903 2:110128716-110128738 ACCATATGAAACTGCCACTTAGG 0: 1
1: 1
2: 8
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936166902 Original CRISPR ATGGTTTAGCCTAATACATC AGG (reversed) Intronic
909273790 1:73658654-73658676 ATGGGTTAGCTTAGTTCATCTGG + Intergenic
909867874 1:80696768-80696790 ATGACTTAGCCGAATACCTCTGG - Intergenic
911642374 1:100302938-100302960 ATGGTTTTGCACAATATATCTGG + Intergenic
915646009 1:157273131-157273153 ATGGTATAGCCTATTGCACCTGG + Intergenic
918621109 1:186606836-186606858 ATGGTCTAGCCTAGCACTTCTGG + Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
920099906 1:203510567-203510589 ATGCTTTAGCTTGAAACATCTGG - Intergenic
921891278 1:220356222-220356244 AGTGTTTAGTCTAATACAGCAGG - Intergenic
924637581 1:245803382-245803404 ATGGTTCAACCTAAAACACCAGG - Intronic
1065693240 10:28356557-28356579 GTGGTTCAGCCTAAAACTTCTGG - Intergenic
1068923882 10:62514549-62514571 ATGGTTTCAGCTAAAACATCAGG - Intronic
1069421288 10:68248800-68248822 ATGGTTTAACCCAAAACCTCTGG - Intergenic
1071385847 10:85120563-85120585 TTGGTTTAGCCAAATTGATCTGG + Intergenic
1079013909 11:16852533-16852555 ATGGTTTATCCTAAGAAAGCAGG + Intronic
1082219288 11:49614048-49614070 ATGGTGTGGCTTAATACATATGG + Intergenic
1083132754 11:60641191-60641213 ATGGTTCAACCTAATACAAGGGG - Intergenic
1086630371 11:89010823-89010845 ATGGTGTGGCTTAATACATATGG - Intronic
1086817027 11:91384700-91384722 ATGGCTTAGCTTAGAACATCTGG - Intergenic
1088481276 11:110298037-110298059 ATTGTTCAGCCTACCACATCAGG + Intergenic
1094336555 12:29362789-29362811 ATGCTTTAGGCAAATTCATCAGG - Intronic
1095870686 12:47024300-47024322 ATGGTTCAACCTAATACATGAGG - Intergenic
1108754096 13:53478832-53478854 ACTGTTTAGCATAATACATAAGG + Intergenic
1109555978 13:63976241-63976263 ATGGTTTAGCCTTGTCCCTCAGG + Intergenic
1114155333 14:20096709-20096731 ATTGTTTAGCCTAATAAATACGG + Intergenic
1114404420 14:22442598-22442620 ACGGTTTTGCAAAATACATCAGG + Intergenic
1120726935 14:87954261-87954283 ATTGTGTGGACTAATACATCAGG - Intronic
1125107099 15:35985042-35985064 ATGCTATTTCCTAATACATCTGG - Intergenic
1130157757 15:81367706-81367728 CTGGGTAAGCCTAATTCATCAGG - Intronic
1132469049 16:91749-91771 CTGGTTTTGCCTAATAGATCTGG + Intronic
1137544384 16:49390783-49390805 ATGGTTTAACCTAAATTATCTGG + Intronic
1138107494 16:54296541-54296563 TTTGTTTAGCCCAATATATCCGG - Intergenic
1139023354 16:62780952-62780974 ATCGTTTAGCCTTATGCATTTGG + Intergenic
1139708879 16:68761279-68761301 GTGGTCTAGGCTGATACATCAGG + Intronic
1139780987 16:69351327-69351349 ATGGTTTGGCTTCTTACATCAGG - Intronic
1146503843 17:33387533-33387555 ATTGCTCAGCCTACTACATCTGG - Intronic
1150840661 17:68602497-68602519 ATGGTTCAGCCTACTACACACGG + Intergenic
1153290568 18:3498361-3498383 ATGGTTTAGTATACTACATAAGG - Exonic
1155130484 18:22929705-22929727 ATGGTTTTGCCTAATTCGTAGGG + Intronic
1156064402 18:33121977-33121999 ATGGTATAGCCTATTGCTTCTGG - Intronic
1156500904 18:37557511-37557533 GTGGAATAGTCTAATACATCGGG + Intronic
1157087347 18:44594829-44594851 ACAGTTTTGCTTAATACATCAGG - Intergenic
1165214095 19:34257229-34257251 AACCTATAGCCTAATACATCAGG + Intronic
1166758042 19:45206388-45206410 ATGGTTTTTCCTGATTCATCTGG + Intronic
933103871 2:78296524-78296546 ATTTTTTAGGCTAGTACATCTGG - Intergenic
934851015 2:97701268-97701290 TTGGGTTGGCCTCATACATCAGG + Intergenic
936166902 2:110128698-110128720 ATGGTTTAGCCTAATACATCAGG - Intronic
941166115 2:162084736-162084758 ATGGTTTAGCCTTATTTATTTGG + Intergenic
941361422 2:164556658-164556680 ATGGTTTATCCTAAGATATGAGG - Intronic
942258533 2:174133288-174133310 ATGGTTTAGCTTATGACTTCTGG + Intronic
943519800 2:188934354-188934376 ATGGTTTAGCATCATCCATTTGG - Intergenic
946473458 2:219984625-219984647 ATGGTTTACAGAAATACATCTGG + Intergenic
1177424133 21:20900387-20900409 ATGATTTATCATAATTCATCAGG + Intergenic
952117261 3:30197595-30197617 ATGGTTTATACTAAGACAGCTGG + Intergenic
963960066 3:151299737-151299759 TTGGTTTAGACTATTAAATCTGG + Intronic
967146928 3:186614286-186614308 ATGGTTCAACCTAATATCTCTGG - Intronic
969984305 4:11191228-11191250 ATGGTTTAGCATCATACTTTTGG - Intergenic
973929029 4:55770807-55770829 ATGGTGTAGCCTATTGCTTCAGG - Intergenic
977597550 4:98900229-98900251 ATTGTTCAACCTAATACATGTGG + Intronic
978094620 4:104761083-104761105 ATGGTATAGCCCAATGCATATGG - Intergenic
979062949 4:116089215-116089237 ATGGCTTAACCTAATACATATGG - Intergenic
979389031 4:120105413-120105435 AGGGTTTAGTTTAATACATCTGG - Intergenic
984080258 4:175239237-175239259 ATGGTATAGCCTATTACTCCTGG - Intergenic
990667531 5:58090804-58090826 ATGGTATAGCCTATTACTCCTGG - Intergenic
995323928 5:110870423-110870445 ATGAGTTACACTAATACATCTGG + Intergenic
1000891619 5:166809095-166809117 GTTGTTTATCCTAATACATTAGG + Intergenic
1009340350 6:62546777-62546799 ATGGTTGAGCCTACTAGATTTGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1023427709 7:40056625-40056647 GTGGTTTGGCCTTATACGTCTGG + Intronic
1028418280 7:90603459-90603481 ATGGTATAGCCTATTACTCCTGG - Intronic
1032066041 7:128771916-128771938 AAGGTTTAGCCAAATGCAACGGG + Intergenic
1046912354 8:119642567-119642589 ATTGTTTGGCCTAATTCATATGG + Intronic
1047392396 8:124463511-124463533 ATTATTTAGCTTAATACTTCAGG + Intergenic
1051313144 9:15798579-15798601 AGGGTTTAGCCTATTAGATCAGG + Intronic
1051702563 9:19839907-19839929 ATGGTATAGCCTATTGCTTCTGG - Intergenic
1055521887 9:77089795-77089817 ATGGTTTGGTTTTATACATCAGG + Intergenic
1056347523 9:85713643-85713665 ATTGTTTAACTTAATACATTTGG + Intronic
1059316195 9:113427652-113427674 ATAATTTAGCATAATACCTCTGG + Intronic
1059551842 9:115237031-115237053 ATGGCTGAGCCTCATACTTCTGG + Intronic
1188950271 X:36363336-36363358 ATGGTATAGCCTATTGCTTCTGG + Intronic
1192092736 X:68177770-68177792 ATGGTTTAGCCTCATCCACTTGG - Intronic
1199285251 X:146047487-146047509 ATGGTATAGCCTATTACTCCTGG + Intergenic
1200314408 X:155116702-155116724 ATTCTTTAGCCTTACACATCTGG + Exonic
1201490253 Y:14533377-14533399 ATATTTTAGTCTAAAACATCTGG + Intronic