ID: 936174606

View in Genome Browser
Species Human (GRCh38)
Location 2:110208814-110208836
Sequence CTCATTAGGTTTCCTTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936174606_936174608 12 Left 936174606 2:110208814-110208836 CCTGGTAAAGGAAACCTAATGAG No data
Right 936174608 2:110208849-110208871 AAACAGTAGTTTTCAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936174606 Original CRISPR CTCATTAGGTTTCCTTTACC AGG (reversed) Intergenic
No off target data available for this crispr