ID: 936174630

View in Genome Browser
Species Human (GRCh38)
Location 2:110209091-110209113
Sequence GTTGATCTACTAGGAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936174626_936174630 6 Left 936174626 2:110209062-110209084 CCAGCTAACAGCCTTTATCTTCT No data
Right 936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG No data
936174625_936174630 7 Left 936174625 2:110209061-110209083 CCCAGCTAACAGCCTTTATCTTC No data
Right 936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG No data
936174628_936174630 -5 Left 936174628 2:110209073-110209095 CCTTTATCTTCTCATATGGTTGA No data
Right 936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936174630 Original CRISPR GTTGATCTACTAGGAATGAA AGG Intergenic
No off target data available for this crispr