ID: 936183388

View in Genome Browser
Species Human (GRCh38)
Location 2:110285488-110285510
Sequence TCGCCTCCTGCGTGGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936183388_936183402 20 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183402 2:110285531-110285553 CCTCCTGGGCAGTGGGGCTGAGG No data
936183388_936183398 12 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183398 2:110285523-110285545 ATGCGTGGCCTCCTGGGCAGTGG No data
936183388_936183396 5 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183396 2:110285516-110285538 CAGGGTCATGCGTGGCCTCCTGG No data
936183388_936183405 30 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183405 2:110285541-110285563 AGTGGGGCTGAGGGTACCTGAGG No data
936183388_936183403 21 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183403 2:110285532-110285554 CTCCTGGGCAGTGGGGCTGAGGG No data
936183388_936183397 6 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183397 2:110285517-110285539 AGGGTCATGCGTGGCCTCCTGGG No data
936183388_936183399 13 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183399 2:110285524-110285546 TGCGTGGCCTCCTGGGCAGTGGG No data
936183388_936183400 14 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183400 2:110285525-110285547 GCGTGGCCTCCTGGGCAGTGGGG No data
936183388_936183395 -3 Left 936183388 2:110285488-110285510 CCCTCAGGCCACGCAGGAGGCGA No data
Right 936183395 2:110285508-110285530 CGAGGAGGCAGGGTCATGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936183388 Original CRISPR TCGCCTCCTGCGTGGCCTGA GGG (reversed) Intergenic