ID: 936183635

View in Genome Browser
Species Human (GRCh38)
Location 2:110286912-110286934
Sequence AGGTGGCGCAGCGCGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936183635_936183644 12 Left 936183635 2:110286912-110286934 CCAGGAACCGCGCTGCGCCACCT No data
Right 936183644 2:110286947-110286969 CTCACATTCTCTTAAGCACCCGG No data
936183635_936183646 25 Left 936183635 2:110286912-110286934 CCAGGAACCGCGCTGCGCCACCT No data
Right 936183646 2:110286960-110286982 AAGCACCCGGTGGCCCTCCGAGG No data
936183635_936183645 15 Left 936183635 2:110286912-110286934 CCAGGAACCGCGCTGCGCCACCT No data
Right 936183645 2:110286950-110286972 ACATTCTCTTAAGCACCCGGTGG No data
936183635_936183648 30 Left 936183635 2:110286912-110286934 CCAGGAACCGCGCTGCGCCACCT No data
Right 936183648 2:110286965-110286987 CCCGGTGGCCCTCCGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936183635 Original CRISPR AGGTGGCGCAGCGCGGTTCC TGG (reversed) Intergenic
No off target data available for this crispr