ID: 936184225

View in Genome Browser
Species Human (GRCh38)
Location 2:110290796-110290818
Sequence ACTGCCCCCTCATTTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936184225_936184231 13 Left 936184225 2:110290796-110290818 CCTGGGACAAATGAGGGGGCAGT No data
Right 936184231 2:110290832-110290854 TGGCAATGAGGTTGCAACTGAGG No data
936184225_936184232 19 Left 936184225 2:110290796-110290818 CCTGGGACAAATGAGGGGGCAGT No data
Right 936184232 2:110290838-110290860 TGAGGTTGCAACTGAGGCTGTGG No data
936184225_936184230 1 Left 936184225 2:110290796-110290818 CCTGGGACAAATGAGGGGGCAGT No data
Right 936184230 2:110290820-110290842 GGAAAAGCTGGCTGGCAATGAGG No data
936184225_936184229 -7 Left 936184225 2:110290796-110290818 CCTGGGACAAATGAGGGGGCAGT No data
Right 936184229 2:110290812-110290834 GGGCAGTGGGAAAAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936184225 Original CRISPR ACTGCCCCCTCATTTGTCCC AGG (reversed) Intergenic
No off target data available for this crispr