ID: 936184232

View in Genome Browser
Species Human (GRCh38)
Location 2:110290838-110290860
Sequence TGAGGTTGCAACTGAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936184225_936184232 19 Left 936184225 2:110290796-110290818 CCTGGGACAAATGAGGGGGCAGT No data
Right 936184232 2:110290838-110290860 TGAGGTTGCAACTGAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936184232 Original CRISPR TGAGGTTGCAACTGAGGCTG TGG Intergenic
No off target data available for this crispr