ID: 936188011

View in Genome Browser
Species Human (GRCh38)
Location 2:110319927-110319949
Sequence TGGAGGAAGTTCAGCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936188004_936188011 15 Left 936188004 2:110319889-110319911 CCCTGGGGGCTGTGAATGGGACT No data
Right 936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG No data
936188005_936188011 14 Left 936188005 2:110319890-110319912 CCTGGGGGCTGTGAATGGGACTT No data
Right 936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936188011 Original CRISPR TGGAGGAAGTTCAGCACAGC AGG Intergenic
No off target data available for this crispr