ID: 936190218

View in Genome Browser
Species Human (GRCh38)
Location 2:110332045-110332067
Sequence CTGTAGGGGTGCCCCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936190218_936190224 9 Left 936190218 2:110332045-110332067 CCAGGTCAGGGGCACCCCTACAG No data
Right 936190224 2:110332077-110332099 TGAACAAGAGAGAATCACTCTGG No data
936190218_936190226 23 Left 936190218 2:110332045-110332067 CCAGGTCAGGGGCACCCCTACAG No data
Right 936190226 2:110332091-110332113 TCACTCTGGGTTACAGTCAGTGG No data
936190218_936190225 10 Left 936190218 2:110332045-110332067 CCAGGTCAGGGGCACCCCTACAG No data
Right 936190225 2:110332078-110332100 GAACAAGAGAGAATCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936190218 Original CRISPR CTGTAGGGGTGCCCCTGACC TGG (reversed) Intergenic
No off target data available for this crispr