ID: 936190613

View in Genome Browser
Species Human (GRCh38)
Location 2:110334416-110334438
Sequence CCTGGGACATTGCATGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936190601_936190613 15 Left 936190601 2:110334378-110334400 CCTCTTCCCCCACCACCCAGGTA No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190609_936190613 -1 Left 936190609 2:110334394-110334416 CCAGGTAAGCAATGAGCAGGAGC No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190602_936190613 9 Left 936190602 2:110334384-110334406 CCCCCACCACCCAGGTAAGCAAT No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190599_936190613 18 Left 936190599 2:110334375-110334397 CCTCCTCTTCCCCCACCACCCAG No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190604_936190613 7 Left 936190604 2:110334386-110334408 CCCACCACCCAGGTAAGCAATGA No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190603_936190613 8 Left 936190603 2:110334385-110334407 CCCCACCACCCAGGTAAGCAATG No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190606_936190613 3 Left 936190606 2:110334390-110334412 CCACCCAGGTAAGCAATGAGCAG No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190608_936190613 0 Left 936190608 2:110334393-110334415 CCCAGGTAAGCAATGAGCAGGAG No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190598_936190613 26 Left 936190598 2:110334367-110334389 CCATTTTACCTCCTCTTCCCCCA No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data
936190605_936190613 6 Left 936190605 2:110334387-110334409 CCACCACCCAGGTAAGCAATGAG No data
Right 936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936190613 Original CRISPR CCTGGGACATTGCATGACAT TGG Intergenic
No off target data available for this crispr