ID: 936191428

View in Genome Browser
Species Human (GRCh38)
Location 2:110338388-110338410
Sequence ACACTTCGAGGGCTCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936191423_936191428 -4 Left 936191423 2:110338369-110338391 CCCTTGGTGGGCTGTGGGGACAC No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191418_936191428 3 Left 936191418 2:110338362-110338384 CCGACACCCCTTGGTGGGCTGTG No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191422_936191428 -3 Left 936191422 2:110338368-110338390 CCCCTTGGTGGGCTGTGGGGACA No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191412_936191428 21 Left 936191412 2:110338344-110338366 CCAGGAGGGGCGCAGACCCCGAC No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191410_936191428 28 Left 936191410 2:110338337-110338359 CCACTGCCCAGGAGGGGCGCAGA No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191416_936191428 5 Left 936191416 2:110338360-110338382 CCCCGACACCCCTTGGTGGGCTG No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191411_936191428 22 Left 936191411 2:110338343-110338365 CCCAGGAGGGGCGCAGACCCCGA No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191424_936191428 -5 Left 936191424 2:110338370-110338392 CCTTGGTGGGCTGTGGGGACACT No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data
936191417_936191428 4 Left 936191417 2:110338361-110338383 CCCGACACCCCTTGGTGGGCTGT No data
Right 936191428 2:110338388-110338410 ACACTTCGAGGGCTCCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936191428 Original CRISPR ACACTTCGAGGGCTCCCTGG CGG Intergenic