ID: 936191897

View in Genome Browser
Species Human (GRCh38)
Location 2:110340613-110340635
Sequence CCTCACACTCTCCCATGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936191897_936191910 25 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191910 2:110340661-110340683 GCTGCGAGGGCAGAAAGCCTTGG No data
936191897_936191902 -10 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191902 2:110340626-110340648 GAGTGTGAGGCTTGGAGAGCCGG No data
936191897_936191904 3 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191904 2:110340639-110340661 GGAGAGCCGGACTTCCACCTGGG No data
936191897_936191906 11 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191906 2:110340647-110340669 GGACTTCCACCTGGGCTGCGAGG No data
936191897_936191907 12 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191907 2:110340648-110340670 GACTTCCACCTGGGCTGCGAGGG No data
936191897_936191912 27 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191912 2:110340663-110340685 TGCGAGGGCAGAAAGCCTTGGGG No data
936191897_936191903 2 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191903 2:110340638-110340660 TGGAGAGCCGGACTTCCACCTGG No data
936191897_936191911 26 Left 936191897 2:110340613-110340635 CCCAGCCATGGGAGAGTGTGAGG No data
Right 936191911 2:110340662-110340684 CTGCGAGGGCAGAAAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936191897 Original CRISPR CCTCACACTCTCCCATGGCT GGG (reversed) Intergenic
No off target data available for this crispr