ID: 936192045

View in Genome Browser
Species Human (GRCh38)
Location 2:110341336-110341358
Sequence GGCCAGAGGCACCACAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936192045_936192048 -7 Left 936192045 2:110341336-110341358 CCATTTCTGTGGTGCCTCTGGCC No data
Right 936192048 2:110341352-110341374 TCTGGCCTGGCTGCGCCCTCTGG No data
936192045_936192056 22 Left 936192045 2:110341336-110341358 CCATTTCTGTGGTGCCTCTGGCC No data
Right 936192056 2:110341381-110341403 CTCCCCCGGCTACTTCTGTCTGG No data
936192045_936192060 26 Left 936192045 2:110341336-110341358 CCATTTCTGTGGTGCCTCTGGCC No data
Right 936192060 2:110341385-110341407 CCCGGCTACTTCTGTCTGGCAGG No data
936192045_936192051 8 Left 936192045 2:110341336-110341358 CCATTTCTGTGGTGCCTCTGGCC No data
Right 936192051 2:110341367-110341389 CCCTCTGGCCCCTGCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936192045 Original CRISPR GGCCAGAGGCACCACAGAAA TGG (reversed) Intergenic
No off target data available for this crispr