ID: 936192302

View in Genome Browser
Species Human (GRCh38)
Location 2:110342610-110342632
Sequence CCAGCAGAGAGTGCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936192302_936192309 22 Left 936192302 2:110342610-110342632 CCAGCTCTGGCACTCTCTGCTGG No data
Right 936192309 2:110342655-110342677 TTAGCTTCCTTCCTCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936192302 Original CRISPR CCAGCAGAGAGTGCCAGAGC TGG (reversed) Intergenic
No off target data available for this crispr