ID: 936197736

View in Genome Browser
Species Human (GRCh38)
Location 2:110384821-110384843
Sequence CCAGCCCAGCACCACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936197736_936197746 0 Left 936197736 2:110384821-110384843 CCTTCCAGGTGGTGCTGGGCTGG No data
Right 936197746 2:110384844-110384866 GGCTGGGCCTGGGACTGGTTAGG No data
936197736_936197745 -5 Left 936197736 2:110384821-110384843 CCTTCCAGGTGGTGCTGGGCTGG No data
Right 936197745 2:110384839-110384861 GCTGGGGCTGGGCCTGGGACTGG No data
936197736_936197747 1 Left 936197736 2:110384821-110384843 CCTTCCAGGTGGTGCTGGGCTGG No data
Right 936197747 2:110384845-110384867 GCTGGGCCTGGGACTGGTTAGGG No data
936197736_936197748 6 Left 936197736 2:110384821-110384843 CCTTCCAGGTGGTGCTGGGCTGG No data
Right 936197748 2:110384850-110384872 GCCTGGGACTGGTTAGGGATCGG No data
936197736_936197744 -10 Left 936197736 2:110384821-110384843 CCTTCCAGGTGGTGCTGGGCTGG No data
Right 936197744 2:110384834-110384856 GCTGGGCTGGGGCTGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936197736 Original CRISPR CCAGCCCAGCACCACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr