ID: 936198586

View in Genome Browser
Species Human (GRCh38)
Location 2:110389956-110389978
Sequence CACGGCAGTCAGGGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936198578_936198586 -4 Left 936198578 2:110389937-110389959 CCTGGTCTGGTACCACCTCCACG No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data
936198577_936198586 6 Left 936198577 2:110389927-110389949 CCTGGGTCAGCCTGGTCTGGTAC No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data
936198575_936198586 8 Left 936198575 2:110389925-110389947 CCCCTGGGTCAGCCTGGTCTGGT No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data
936198572_936198586 16 Left 936198572 2:110389917-110389939 CCTAAGGTCCCCTGGGTCAGCCT No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data
936198571_936198586 17 Left 936198571 2:110389916-110389938 CCCTAAGGTCCCCTGGGTCAGCC No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data
936198576_936198586 7 Left 936198576 2:110389926-110389948 CCCTGGGTCAGCCTGGTCTGGTA No data
Right 936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936198586 Original CRISPR CACGGCAGTCAGGGGAAAGC AGG Intergenic
No off target data available for this crispr