ID: 936198638

View in Genome Browser
Species Human (GRCh38)
Location 2:110390208-110390230
Sequence CCTTCTGAGCAGAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936198630_936198638 24 Left 936198630 2:110390161-110390183 CCACTGTGCTCCAAGGTTCTTAG No data
Right 936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG No data
936198631_936198638 14 Left 936198631 2:110390171-110390193 CCAAGGTTCTTAGAAAATGCTTT No data
Right 936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG No data
936198629_936198638 25 Left 936198629 2:110390160-110390182 CCCACTGTGCTCCAAGGTTCTTA No data
Right 936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936198638 Original CRISPR CCTTCTGAGCAGAGAGAGGC AGG Intergenic
No off target data available for this crispr