ID: 936202776

View in Genome Browser
Species Human (GRCh38)
Location 2:110423436-110423458
Sequence GCTGAGCAGCCCAATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 3, 1: 0, 2: 0, 3: 15, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936202776 Original CRISPR GCTGAGCAGCCCAATGAGCA GGG Intronic
900265612 1:1755706-1755728 GCTGAGCGGCCCCCTGGGCACGG + Intronic
902778906 1:18692144-18692166 GCTGGACAGCCCAAGGAGGAGGG + Intronic
904045702 1:27607082-27607104 CCTGAGCAGCCCCAGGAGTAGGG - Intergenic
911151499 1:94600725-94600747 GCTGAGCAGGGCACTGAGCAGGG + Intergenic
915168176 1:153960110-153960132 GAAGAGCAGGCCAGTGAGCAGGG + Exonic
915203204 1:154249337-154249359 GCTGAGCTGCCAACTGAGCCAGG - Exonic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
919786042 1:201259453-201259475 CCTGAGCAGCCCCAAGAGCTGGG + Intergenic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
921722822 1:218492344-218492366 GCTGAGCATACCAAGGAGGAAGG - Intergenic
1063542778 10:6950940-6950962 GGAGAGCAGCCCTATGGGCAGGG + Intergenic
1064014751 10:11763273-11763295 GCTAAGCAGCCCGTGGAGCAGGG - Exonic
1067850110 10:49749351-49749373 GCTGGGCAAACAAATGAGCAAGG + Intronic
1069809605 10:71148674-71148696 GCTGAGCAGGGCAGTGAGCCAGG + Intergenic
1070148626 10:73792154-73792176 GCTGTGCGGCCCAAGGAGCCTGG + Exonic
1071895312 10:90060125-90060147 GCTGAGCAGCCTATTGTTCAAGG - Intergenic
1072710704 10:97714070-97714092 GGTGAGCAGCCAGAAGAGCACGG - Exonic
1074162784 10:110847662-110847684 GTAGAGCAGCTCAATCAGCAGGG + Intergenic
1074274476 10:111988317-111988339 CATCAGCAGCCCAATGAGCAAGG - Intergenic
1075716795 10:124560512-124560534 CCTGAGCAGGCCAACGAGGAGGG - Intronic
1077146522 11:1048950-1048972 GCTGCCCAGCCCCACGAGCAGGG - Intergenic
1077893476 11:6436744-6436766 GCTCAGCAGGGCATTGAGCAAGG + Intronic
1078879999 11:15438593-15438615 GTTGAGCTGTCCTATGAGCAGGG - Intergenic
1079327203 11:19504551-19504573 TCAGAGCAGCCCAATGTGAAAGG + Intronic
1083180685 11:60982813-60982835 GCTGAGAAGCCCAGTCTGCAGGG + Intronic
1083715849 11:64576542-64576564 CCTGAGCAGCCAAATGTGGATGG - Intergenic
1085150880 11:74252080-74252102 GCTGGGCAGGCCATGGAGCAGGG + Intronic
1085423784 11:76385228-76385250 TCTGAGCAGCCAAATGTGAATGG - Intronic
1089364702 11:117914569-117914591 ACTGAGCAGCCCAAGGACCTGGG + Intronic
1089533526 11:119147635-119147657 TCTGAGAGGCCCAATTAGCAGGG + Intergenic
1089739865 11:120575081-120575103 GCTGAGAAGCCTGATGAGCAGGG - Intronic
1091637148 12:2205786-2205808 GCTGGGCAGCCCCAGGATCAAGG + Intronic
1093916019 12:24803356-24803378 CCTTTGCAGCCCAATGAACAGGG - Intergenic
1094531797 12:31282749-31282771 GCTGAGAAGCCAGAGGAGCAGGG - Exonic
1096518416 12:52170843-52170865 TCTGGGGAGCCCAAAGAGCACGG + Exonic
1101208153 12:102509572-102509594 GGTGAGTTGCCCAATAAGCAGGG + Intergenic
1101468805 12:104975770-104975792 GTTGAGCATCACAATCAGCAGGG - Intergenic
1103443278 12:120978940-120978962 GCTGAGCTGCCCAATGGGCTGGG + Exonic
1105894982 13:24709871-24709893 TCTGCGCAGGGCAATGAGCATGG - Intronic
1112720847 13:102242894-102242916 GCTGTGCAGCCCAATGCCTAGGG - Intronic
1114568510 14:23649488-23649510 ACTGGACAGCCCAAGGAGCATGG - Intergenic
1116667948 14:47801541-47801563 GCTGGGCAACCCCATGATCAAGG - Intergenic
1116960665 14:50965210-50965232 GCTTGGCAGCAAAATGAGCAAGG - Intergenic
1117051507 14:51865016-51865038 GCTGGGCAGAACAATTAGCAGGG + Intronic
1117841600 14:59866426-59866448 TATGAGCAGGGCAATGAGCAGGG + Intronic
1119757700 14:77130569-77130591 CCTGAGCAGACGAATGAGCAAGG - Intronic
1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG + Intronic
1122036657 14:98954002-98954024 GCTGAGCAGCTCCCGGAGCAGGG + Intergenic
1123006336 14:105325571-105325593 GCTCAGCAGCCCCAGGAGCCAGG + Intronic
1123182037 14:106480348-106480370 GCGCAGCAGCCCAAGGAGCGCGG + Intergenic
1202944868 14_KI270726v1_random:16382-16404 GCGCAGCAGCCCAAGGAGCGCGG - Intergenic
1124605125 15:31163805-31163827 GCTGTGCTGCCCAAGGAGCATGG - Intergenic
1129246606 15:74282817-74282839 GCACTGCAGCCAAATGAGCAGGG - Intronic
1129648810 15:77464698-77464720 GCTGAGCAGAGCCTTGAGCAAGG - Intronic
1132944861 16:2527272-2527294 GCACAGCAGCCCAGGGAGCAGGG - Intronic
1133042310 16:3067123-3067145 GCTGGGCAGGCCCAAGAGCAGGG - Intronic
1135475011 16:22766217-22766239 GCTGTGGAGGCCCATGAGCAAGG + Intergenic
1135925966 16:26694489-26694511 GCTGAGCTGCCTAATGACCATGG - Intergenic
1137484095 16:48877307-48877329 GCTGAGCTGCCCAAATAGTATGG - Intergenic
1140803534 16:78511017-78511039 GCTGAGCAGCCCACTATGCCAGG - Intronic
1143106354 17:4532390-4532412 TCTCAGCAGCCCAATTAGGAAGG + Intronic
1143240413 17:5438933-5438955 GCTGAGCAGCCCGAAGGGCCGGG + Exonic
1144658314 17:17052123-17052145 GCTGAGCAGCTCAGTGACCTTGG - Intronic
1144684218 17:17215582-17215604 GCTAAGCAGCCCTATGAGGGTGG + Intronic
1146312481 17:31779852-31779874 GCTGAGCATCAAAAAGAGCATGG - Intergenic
1146579479 17:34024173-34024195 GCTGAGCAGCCCAATCTGGCTGG - Intronic
1148072635 17:44916987-44917009 TCCGAGAAGCCCATTGAGCAGGG - Intergenic
1151713545 17:75819958-75819980 GCAGAGCTGCCCAAGGAGCCGGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152899010 17:82929418-82929440 GGTGGGCAGCCCAAGGAGCTGGG - Exonic
1152991082 18:364412-364434 GTTGAGCTCCCCAGTGAGCAAGG - Intronic
1156147853 18:34207907-34207929 GCAGTGCAGCTCCATGAGCAGGG + Intronic
1157272987 18:46290801-46290823 GCTGTGCTGCAAAATGAGCATGG - Intergenic
1161061395 19:2216956-2216978 GCTGAGCACACCAAGGAGAACGG + Exonic
1163020407 19:14478294-14478316 GCTCAGCAGCCCAAGGACGATGG - Exonic
1164894752 19:31863925-31863947 TCTGAACAGACCAATGAGTAAGG + Intergenic
1165733967 19:38164247-38164269 TCTGAGCAGCCCCATGAGGCAGG + Intronic
925444265 2:3914414-3914436 GCTGAGCAGCCCCGGGGGCAGGG - Intergenic
925719119 2:6811159-6811181 GCAGAGCAGCACAGTGAGCATGG + Intergenic
926783199 2:16494579-16494601 GCTGAGAAGACAAATGAGTAAGG - Intergenic
926907186 2:17816711-17816733 GCTGGGCTGCCCTGTGAGCACGG + Exonic
927789674 2:26000570-26000592 GCAGAGCAGCCCCAAGAGCTGGG + Intergenic
928236415 2:29545444-29545466 GCAAAGCATGCCAATGAGCACGG - Intronic
928444589 2:31321860-31321882 GCTGAGCAGTCCAGTGGGCTTGG + Intergenic
931652519 2:64481377-64481399 GCGGAACACCCCAAGGAGCAAGG + Intergenic
932543361 2:72680621-72680643 GCTCAGCATCCCAAGTAGCAGGG - Intronic
932718486 2:74120589-74120611 GCTGAGGAGCCCAAGGAGCGGGG + Intergenic
934619458 2:95795230-95795252 GCTGAGTGGCCAACTGAGCAAGG + Intergenic
934641432 2:96029327-96029349 GCTGAGTGGCCAACTGAGCAAGG - Intronic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
936141914 2:109948048-109948070 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936178602 2:110245996-110246018 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936202776 2:110423436-110423458 GCTGAGCAGCCCAATGAGCAGGG + Intronic
936757301 2:115730549-115730571 ACGGAGCAGCACAATAAGCATGG - Intronic
936831238 2:116650440-116650462 GCTGAGCAGGCCAAGGAGGAAGG + Intergenic
937442244 2:121926446-121926468 GCAGAGCAGGACAAGGAGCAGGG + Intergenic
937929565 2:127193552-127193574 GGGGAGCAGGCCAAGGAGCATGG + Intronic
938420128 2:131138967-131138989 GCTCAGCAGGCCAAATAGCAAGG - Intronic
939792785 2:146599999-146600021 TCTGAGCAGCCCATGGACCACGG - Intergenic
946309858 2:218877497-218877519 GCTGAGCAGCTGGATGAGCAGGG - Intergenic
1168912205 20:1457866-1457888 GAAGAGCACCGCAATGAGCACGG + Intronic
1170138677 20:13103538-13103560 GCTGAGCAACCCAGAGAGTAGGG + Intronic
1172155870 20:32823966-32823988 GCTCTCCAGCCCAGTGAGCAAGG - Intronic
1172692152 20:36797369-36797391 GCTGAGGAGCCCAAGGTGCAAGG + Intronic
1173701284 20:45074169-45074191 GATGAACAGCCCAAGGAGGAGGG - Intronic
1175873669 20:62219836-62219858 GATGAGCAGCGCCATGAGCGCGG + Exonic
1179578011 21:42319828-42319850 GCAGAGCAGCCCAGTGGGCTCGG + Intergenic
1182454351 22:30440284-30440306 GAAGAGCAGGCCAGTGAGCAGGG - Intergenic
1184015784 22:41784749-41784771 GTTCTGCAGCCCAATGACCAGGG - Exonic
1184092659 22:42300622-42300644 GGTCAGCAGCCCAAGGGGCAGGG + Intronic
950706510 3:14785769-14785791 GCTCACCAGCCCAGTGAGGATGG - Intergenic
954498561 3:50988430-50988452 GCTAAGTAGCCCAAACAGCAAGG - Intronic
955316211 3:57941303-57941325 GCTGGGAAGTCCAAGGAGCATGG + Intergenic
955752760 3:62199192-62199214 TTTGAGCAGCTCAATGATCATGG + Intronic
958511130 3:95050420-95050442 GCTGAGCAGCCCCAAGAGATGGG + Intergenic
960419610 3:117427612-117427634 GCAAAGCAGCCCACTGAGCCTGG + Intergenic
960629041 3:119710284-119710306 GCTGGGCAGTCCAAGAAGCAAGG + Intronic
962935509 3:140076912-140076934 GCTGAGCATCCCACCGTGCAAGG - Intronic
962982053 3:140499535-140499557 GCTGAGCTGCCCAATGGCCTGGG + Intronic
965519445 3:169658593-169658615 GCTGAGCAGCCTGAGGAGCGAGG + Intronic
965986246 3:174757309-174757331 GCTGAGGTAGCCAATGAGCAAGG + Intronic
966198075 3:177333681-177333703 GCTGAGTAACCCAATAAGAAAGG - Intergenic
968978839 4:3835912-3835934 GCTGAGCTGCCCAAGGCCCAAGG - Intergenic
973755094 4:54066248-54066270 GCTGAGCATCCCAATGGGGCAGG - Intronic
976111771 4:81683005-81683027 GATGACCAGCCAAATGAGCTGGG + Intronic
981324668 4:143432122-143432144 GCTGGCCAGCCCACTGCGCAGGG + Intronic
982619018 4:157679459-157679481 GCTGGGAAGCCTCATGAGCATGG + Intergenic
987101506 5:14595147-14595169 ACTGAGCAGGCCAGGGAGCAGGG - Intronic
992123075 5:73614467-73614489 GCTGAGCAGACCAAAGAGATGGG + Intergenic
997855870 5:137372153-137372175 GCTGAGTAGCCACATGAGCCTGG + Intronic
1000015183 5:157269433-157269455 ACAGAGCAGCACAGTGAGCATGG + Intronic
1003001102 6:2334443-2334465 CCTCAGCAGCCCAAGTAGCAAGG - Intergenic
1003503985 6:6725062-6725084 GCTGAGTAACCCAAAGGGCATGG - Intergenic
1004960200 6:20779783-20779805 GCAGACCAGCCCAACCAGCATGG - Intronic
1005044473 6:21628891-21628913 GCTGAGCATCCCAAGGTTCAGGG + Intergenic
1006504401 6:34478873-34478895 GCTGAGAAGTCCAAGCAGCATGG + Intronic
1007352087 6:41281289-41281311 GCTGAGGAGGGAAATGAGCATGG + Intronic
1007418047 6:41703440-41703462 GAGGAGCAGCCCCAGGAGCAGGG - Intronic
1007812411 6:44495783-44495805 GCTGAGCAGGCAGATGAACAAGG - Intergenic
1007910016 6:45504149-45504171 GCTGAGAAGCCCCAAGAGCAAGG - Intronic
1013014177 6:106146107-106146129 GCTGAGCAGACAAAAGAGCCCGG + Intergenic
1014338169 6:120166188-120166210 GCTGAGGTAACCAATGAGCAGGG - Intergenic
1017363155 6:153600371-153600393 TCTGAGCAGCCCAATTCCCAGGG - Intergenic
1017980125 6:159394132-159394154 GCTGAGCAGCCCAAACTCCAGGG + Intergenic
1019059457 6:169245191-169245213 GTTGAGCTCCCCAGTGAGCAGGG - Intronic
1019165590 6:170095696-170095718 TCTCTGCAGCTCAATGAGCATGG + Intergenic
1021167334 7:17357611-17357633 GCTGAGCATCCCAATGCTTACGG + Intergenic
1022523422 7:31022396-31022418 GATGAGCAGCACATGGAGCAGGG + Intergenic
1022524357 7:31027854-31027876 GCTGAGCAGCCCAAGGCCCTGGG - Intergenic
1026509940 7:71019389-71019411 GCTGGGCAGCCCCAGGAGGAGGG - Intergenic
1027050112 7:75016505-75016527 CCAGAGAAGCCCAATGTGCAGGG + Intronic
1029222586 7:99002178-99002200 GCTGAGCTGCACCATCAGCACGG - Intronic
1029382923 7:100225163-100225185 CCAGAGAAGCCCAATGTGCAGGG - Intronic
1029791813 7:102851350-102851372 GCTGAGAAGTCCACAGAGCATGG - Intronic
1032260941 7:130336541-130336563 ACTGAGCACCACTATGAGCAAGG - Intergenic
1033346236 7:140527357-140527379 GGAGAGCAGCCCGATGAGGAAGG + Exonic
1033353536 7:140581668-140581690 GATGAGCAGAATAATGAGCACGG + Intronic
1033513191 7:142081304-142081326 GCTGTGTAGCCAAAAGAGCAGGG + Intronic
1036666125 8:10741368-10741390 CCTGAGCAGCCCAAGTAGCTGGG + Intronic
1037549131 8:19952670-19952692 GCTGACCAGGCAAATGAACATGG + Intronic
1038030450 8:23634390-23634412 GCTGAGAAGCCAGAGGAGCAGGG - Intergenic
1038412358 8:27368322-27368344 GCTTAGCAGGCCAAGGAGCAGGG - Intronic
1038487952 8:27949934-27949956 GCTTAGCAGCACCATCAGCAAGG - Intronic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1048612303 8:136036107-136036129 TCTGACCACCCCAAAGAGCAGGG + Intergenic
1048878418 8:138854542-138854564 GCTGAGCAGGCCAAAGGGGAGGG - Intronic
1049436189 8:142587313-142587335 GCTCAGCAGCCCCAAGGGCAGGG - Intergenic
1051129152 9:13840204-13840226 GCTGCACAGCCGAAAGAGCAGGG - Intergenic
1052639695 9:31151060-31151082 GCTGGGAAGCCCAAGAAGCATGG + Intergenic
1055326593 9:75136843-75136865 GCAGTGCAGCCCCATGTGCAGGG - Intronic
1057171100 9:92963736-92963758 GCTGAGCAGCCCCACCAGGAGGG - Intronic
1057807715 9:98232433-98232455 GCTGAGCATCCCAAGTAGCTGGG + Intronic
1057930700 9:99190527-99190549 GCTCAGAAGCCCAATGTGCTGGG - Intergenic
1057973779 9:99582268-99582290 GCTGAGCAGCAACATGACCATGG + Intergenic
1058293940 9:103281234-103281256 GCTGAGGAGGCCATAGAGCAAGG - Intergenic
1059419893 9:114184298-114184320 GCTCAGCAGCTCACTGTGCATGG - Intronic
1060293287 9:122324320-122324342 GCTGAACAGCCCAATGAAGGAGG + Intergenic
1060294623 9:122334881-122334903 ACTGGGCAGCCAAAGGAGCAGGG - Intergenic
1186371629 X:8952840-8952862 GCTGAACAGCCCACACAGCAGGG + Intergenic
1186757202 X:12684555-12684577 GCTGTGCTGCCCTGTGAGCATGG + Intronic
1192454107 X:71263212-71263234 CCTCAGCGGCCCAAAGAGCAAGG - Intergenic
1197077106 X:122365132-122365154 GCTGAGCAGCCCTATTTCCATGG - Intergenic
1197140780 X:123115228-123115250 GCTGAACAGCCCAATGAAGGAGG - Intergenic
1198087588 X:133295243-133295265 GATGAGCAGCAAAATCAGCAGGG - Intergenic
1198183203 X:134230107-134230129 GCTGAGCACCTCAATGTGCCTGG - Intergenic
1199172206 X:144745063-144745085 GCTGATCACCCCAAAGACCACGG + Intergenic
1200151772 X:153954720-153954742 GCTGAGCAGCCCAAGCATTAAGG - Exonic