ID: 936204570

View in Genome Browser
Species Human (GRCh38)
Location 2:110439253-110439275
Sequence CTACTTACAAAGGTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 3, 1: 0, 2: 2, 3: 41, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936204570 Original CRISPR CTACTTACAAAGGTGGGGGT GGG Intronic
900884617 1:5405566-5405588 CCACTTACATGGGTGGAGGTGGG - Intergenic
902558844 1:17263908-17263930 CTCCTTACAAAGGAGTGGGTGGG + Intronic
903606101 1:24576225-24576247 CTCCTGACAAAGCTGGGGGCTGG + Intronic
905979493 1:42210917-42210939 CTACTCCCAAGGGAGGGGGTGGG + Intronic
906237680 1:44221701-44221723 GCTCTTACAAGGGTGGGGGTGGG + Intronic
906254785 1:44339924-44339946 CCACTTACTAGTGTGGGGGTTGG - Intronic
907074745 1:51568010-51568032 CTATTTACAAAGGTTGGGGCAGG + Intergenic
907886824 1:58599580-58599602 CTACTTAGAAAGATTTGGGTGGG - Intergenic
908026477 1:59957331-59957353 CTACCAAGGAAGGTGGGGGTGGG + Intergenic
908829498 1:68165067-68165089 CTACTTATAACGCTGGGAGTAGG + Intronic
909236929 1:73164658-73164680 CTATTTACAAAGGTGTGGACAGG + Intergenic
909735811 1:78960651-78960673 CAACATACAAATTTGGGGGTGGG - Intronic
911227219 1:95319297-95319319 CTATTTTCAATGGTGGGGGTGGG + Intergenic
912436449 1:109665328-109665350 CTCAGAACAAAGGTGGGGGTGGG - Intronic
912438540 1:109680052-109680074 CTCAGAACAAAGGTGGGGGTGGG - Intronic
912441058 1:109698506-109698528 CTCAGAACAAAGGTGGGGGTGGG - Intronic
912853624 1:113148135-113148157 CTACACAGAAAGGTGGGGGAAGG - Intergenic
913016709 1:114744136-114744158 ATGCTAACAAAGGTGGTGGTAGG + Intronic
916330042 1:163605212-163605234 GTTCTTACAAAGGTCAGGGTAGG - Intergenic
916670270 1:167011209-167011231 CTGCATATAAAGGTTGGGGTAGG + Intronic
917675169 1:177311932-177311954 ATGCTTCCAAAGGCGGGGGTGGG - Intergenic
918333407 1:183482404-183482426 CTACTTACAAAAGTAGGGGGAGG - Intronic
919297391 1:195720542-195720564 CTATTACCAAGGGTGGGGGTGGG + Intergenic
919685731 1:200482056-200482078 CTACTTATAAGTGAGGGGGTCGG - Intergenic
919971613 1:202583933-202583955 TTACTTCCAAAGGTGTGGCTCGG - Exonic
920523792 1:206650146-206650168 CTACTTACAAGGGTGGAGACGGG + Intronic
920577132 1:207069801-207069823 CCACTTACTTATGTGGGGGTGGG - Intronic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
921669887 1:217913681-217913703 CTAATTACAAAGGTGTGGATGGG - Intergenic
923081593 1:230661964-230661986 CTATCTCCAAGGGTGGGGGTAGG - Intronic
923090367 1:230735866-230735888 CTATTTACAAAGATGTGGGCAGG - Intergenic
924662838 1:246037704-246037726 CAACTTACAGAGGTGAGGGCAGG - Intronic
1062826055 10:569759-569781 CTACCCACAAAGGCAGGGGTAGG + Intronic
1063756097 10:9010450-9010472 CTGATTTCAAAGGTGGGGGATGG - Intergenic
1065005922 10:21379986-21380008 CTATTTACAAAGCTGCGGGCAGG - Intergenic
1065206583 10:23362898-23362920 AGATTTACAAAGGTGTGGGTGGG + Intergenic
1066081975 10:31939907-31939929 CTATTCACAAAGGTGAGGGTAGG - Intergenic
1070089255 10:73268803-73268825 CTACTTTCGAGGGTTGGGGTGGG - Intronic
1070335788 10:75454221-75454243 CTACACAGAAAGGTGGGGGAAGG + Intronic
1071366034 10:84901403-84901425 CTGTTTACAAAGGTGAGGGCAGG - Intergenic
1073739816 10:106393551-106393573 CTACTTATAGAGGTGTGGGCAGG - Intergenic
1074954001 10:118369904-118369926 ATATTTACAAAGGTGTGAGTGGG + Intergenic
1076223252 10:128751804-128751826 CTCCTGAAAAAGGTGGGGGCTGG + Intergenic
1078365339 11:10701776-10701798 CTGCTTACAGAGGTAGGGGAGGG - Intergenic
1078432004 11:11295314-11295336 CCATTTTCAAAGGTGTGGGTAGG + Intronic
1078617966 11:12882435-12882457 CTACACACACAGGTGGGGATGGG - Intronic
1079773252 11:24490859-24490881 TTACTTACAAAGAAGGTGGTAGG + Intergenic
1080226204 11:29963767-29963789 CTATTTACAAAGGTAAGGGCAGG + Intergenic
1080344294 11:31306224-31306246 CTAGTTACCAAGGTGATGGTTGG + Exonic
1080414703 11:32058389-32058411 CTACTTATAAAGGTGTGGACAGG + Intronic
1083386370 11:62313227-62313249 CTCTTTACAAAGGTGTGGGCAGG - Intergenic
1084482183 11:69428410-69428432 ATACATACAAAGCTGGGGATTGG - Intergenic
1084726930 11:70947976-70947998 CTAGCTGCAGAGGTGGGGGTGGG - Intronic
1086767613 11:90717737-90717759 CTAGAAACAAAGGTGGAGGTGGG - Intergenic
1088053614 11:105549763-105549785 CTACATGGAAAGGTGGGGGAAGG + Intergenic
1088535997 11:110862126-110862148 CTATTTACAAAGGTGTGGCCAGG + Intergenic
1090742767 11:129680903-129680925 CCACTTACAATGGTGGGGTAGGG + Intergenic
1091576180 12:1737981-1738003 CTACATACTAAGGCAGGGGTGGG + Intronic
1091861889 12:3792845-3792867 CTACTTTGAAGGATGGGGGTTGG - Intronic
1094526601 12:31235258-31235280 CGCCTTCCAAAGCTGGGGGTGGG - Intergenic
1094743242 12:33313809-33313831 CTACATAGAAAGGTGGGGGGAGG + Intergenic
1096118774 12:49072553-49072575 CTATTTACAAAGATGTGGGCAGG - Intergenic
1097491667 12:60279291-60279313 CTACTGACAATAGTGGGGGTAGG - Intergenic
1098189539 12:67933663-67933685 CTACTTACAAAGCTAGAAGTTGG - Intergenic
1100548047 12:95621956-95621978 ATACTTCCAGTGGTGGGGGTGGG + Intergenic
1100830471 12:98512415-98512437 CTATTAATAAAAGTGGGGGTTGG - Intergenic
1102517711 12:113461412-113461434 CTACTTGCAAAAGCAGGGGTTGG - Intergenic
1102635077 12:114316325-114316347 CTATTTATAAAGGTGTGGGCAGG + Intergenic
1102919735 12:116782887-116782909 CTATTTACAAAGGTGCGGGCAGG - Intronic
1105255224 13:18739761-18739783 CTGTTTACAAAGGTGTGGGCAGG - Intergenic
1105693965 13:22870401-22870423 CAGCTTACAAAGGTCTGGGTAGG + Intergenic
1106558596 13:30830553-30830575 TTATTTACAAAGGTGTGGGCAGG + Intergenic
1108816348 13:54296181-54296203 CTATTTACAAAGGTGTGAGGTGG + Intergenic
1112467425 13:99656073-99656095 ATAATCTCAAAGGTGGGGGTGGG - Intronic
1115302010 14:31894986-31895008 CTATTTACAAAGGTTTGGGCAGG - Intergenic
1115451713 14:33555590-33555612 CAACTTAAAAAGGTGGGAGGAGG - Intronic
1115713791 14:36079760-36079782 ATAATTAAAAAGGTGGTGGTGGG + Intergenic
1116047462 14:39762528-39762550 CTACTTAAAAGAGTGGGGGGAGG - Intergenic
1117108713 14:52426264-52426286 CACCTTACAGAGGTGGGTGTGGG + Intergenic
1118353402 14:64990588-64990610 CTATTTACAAAGATGTGGGCAGG - Intronic
1118465376 14:66025832-66025854 CTTCTTACAAAGGTGTGGGCAGG + Intergenic
1118492446 14:66274082-66274104 TTACTTACCAAGGTGTGGGCAGG - Intergenic
1119126270 14:72130054-72130076 CTGACTACAAATGTGGGGGTTGG + Intronic
1120526743 14:85585134-85585156 CTACCTACAAGGTTGGAGGTGGG + Intronic
1120947760 14:90013869-90013891 CTTCTTACAAAGGTGGTAGCAGG - Intronic
1122298252 14:100717522-100717544 CTACTTACAGAGATGTGGGCAGG - Intergenic
1122887529 14:104716986-104717008 CTAAATAAAAAGGTGGGGGCTGG - Intronic
1123485380 15:20730963-20730985 CTACTCGCAGGGGTGGGGGTGGG + Intergenic
1124337524 15:28868473-28868495 CTATTTACAAAGGCGGGGCAGGG + Intergenic
1125243668 15:37607516-37607538 CTACTTACAAAGTTGCCTGTAGG + Intergenic
1126195790 15:45929260-45929282 CTTCTGACAAAGATGGGGGCGGG + Intergenic
1126739064 15:51759793-51759815 CTATTTACAAAGATGGGGGGAGG + Intronic
1126815548 15:52449888-52449910 CTACTTAGAAAGCTGAGGTTGGG + Intronic
1126916331 15:53470052-53470074 CTACTGTCAAAGGTTGGGGTTGG + Intergenic
1127473334 15:59309878-59309900 CTATTTACAAATGTGGTGGGTGG - Intronic
1127534694 15:59879186-59879208 CTGCTTTAAAAAGTGGGGGTTGG - Intergenic
1128594213 15:68929906-68929928 CTTCTTAAAAAGATAGGGGTAGG - Intronic
1128606016 15:69037207-69037229 CAAGGTACAAAGGTGGGGGATGG + Exonic
1128675828 15:69607784-69607806 CTACTTACCTAGGTGTGGGCAGG + Intergenic
1129786109 15:78311233-78311255 TTATTTACAAAGTTGGTGGTGGG + Intergenic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1131252359 15:90838875-90838897 GTACTCACAAAGTGGGGGGTGGG - Intergenic
1131570250 15:93527746-93527768 CAACATACAAATGTGGGGGTGGG - Intergenic
1131846521 15:96495102-96495124 CTATTTACAAAGATTGGGGCAGG + Intergenic
1131848636 15:96514570-96514592 ATACTCACTAAGGTGGGCGTGGG - Intergenic
1202950183 15_KI270727v1_random:27154-27176 CTACTCGCAGGGGTGGGGGTGGG + Intergenic
1134861311 16:17562733-17562755 CAATTTACAAAGGTGTGGGCAGG - Intergenic
1137263803 16:46852357-46852379 CTACTAACAAAGGTGTGAGAAGG - Intergenic
1137539135 16:49350025-49350047 CTACTTCAAAAGGTGCAGGTGGG + Intergenic
1137789749 16:51165135-51165157 CTACTGTAAAAGTTGGGGGTGGG - Intergenic
1139437784 16:66946695-66946717 CTTCTGACAAAAGTGGGGTTAGG - Intergenic
1140734731 16:77888136-77888158 CTACTTTCAAGAGTGGGGCTGGG - Intronic
1144169967 17:12649960-12649982 ATATTTACAAAGTTGTGGGTGGG + Intergenic
1144677710 17:17172630-17172652 CTGCTGACAGGGGTGGGGGTGGG - Intronic
1146224246 17:31051996-31052018 CTGCTTACAGAGGTGAGGGAAGG + Intergenic
1146820593 17:35981179-35981201 CTACTTACAAAGGGGAGAATTGG + Intronic
1151295517 17:73183189-73183211 CTACATACAGAGGTGGGGGCAGG + Intergenic
1152710763 17:81869651-81869673 CTACTTCCACTGGTGGGGGTGGG - Intronic
1155979682 18:32167095-32167117 CTACATGCAAATGTGGGGGCTGG - Intronic
1156680098 18:39578128-39578150 CTAATTACCAAGATGTGGGTTGG + Intergenic
1158321484 18:56268747-56268769 AGACTTACAAAGGTGTGGGAAGG - Intergenic
1159459859 18:68711312-68711334 ATACTTAAAATGGTAGGGGTGGG + Intronic
1159857998 18:73612787-73612809 CTATTTACAGAGGTGTGGGTGGG + Intergenic
1162003619 19:7763715-7763737 GGACCTACAGAGGTGGGGGTTGG + Intronic
1164429807 19:28177342-28177364 CTATTTACAAAAGTGTGAGTAGG - Intergenic
1164513560 19:28915943-28915965 CCACTAACAAAGGGGGGGGTAGG + Intergenic
1165162318 19:33824136-33824158 GTATTTACAAAGGTGAGGGCAGG - Intergenic
1166116317 19:40657227-40657249 CTAAATAGAAGGGTGGGGGTAGG - Intergenic
1166194038 19:41194533-41194555 CTTCTTACTCAGCTGGGGGTAGG - Exonic
1166626959 19:44366648-44366670 CTTTTTAAAAAAGTGGGGGTGGG - Intronic
925958942 2:8996752-8996774 CTATTTACAAAGATGTGGGCAGG - Intronic
926742256 2:16122055-16122077 CTACTTGCAAAGCTGAGGGTGGG - Intergenic
926778297 2:16443921-16443943 CAACATACAAATTTGGGGGTGGG + Intergenic
927029407 2:19104816-19104838 CTATTTACAAAGGTGTGTGCAGG - Intergenic
927595488 2:24393193-24393215 CTATTTACAGAGGTGTGGGCAGG - Intergenic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
928890735 2:36200088-36200110 CAACTTACAAATGTGTGGGCAGG - Intergenic
929693084 2:44090738-44090760 CTATTTACAAAGGTGCAGGCAGG - Intergenic
930198160 2:48529632-48529654 CTAATTACAAGGTGGGGGGTGGG + Intronic
930648438 2:53937880-53937902 CTACTCAGAAAGCTGGGGTTGGG + Intronic
931744060 2:65276431-65276453 CTAGTTTCAATGGTGGGGATGGG - Intergenic
932365943 2:71153681-71153703 CGACTTGCACAGGTGGGGGCTGG + Intergenic
932839653 2:75070198-75070220 ATACATACAATGTTGGGGGTAGG - Intronic
934490195 2:94756998-94757020 CTGTTTACAAAGGTGTGGGCTGG - Intergenic
935328949 2:101962300-101962322 CTCTTTCCCAAGGTGGGGGTGGG + Intergenic
935412486 2:102780469-102780491 CTGCTGACAAAGGTGGTGGGAGG + Intronic
936140126 2:109932233-109932255 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936176815 2:110230178-110230200 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936204570 2:110439253-110439275 CTACTTACAAAGGTGGGGGTGGG + Intronic
936497169 2:113032519-113032541 CTGCTTACAAGGGTGCAGGTTGG - Intronic
936833651 2:116680487-116680509 CTAATTACAAAGGTAGGGTGAGG - Intergenic
939007458 2:136805918-136805940 TTACTTACAAAGGTGTTGGCTGG - Intronic
939450257 2:142364564-142364586 CTATTTACAAAGGTGTGAGTGGG + Intergenic
939718647 2:145617799-145617821 TTACTAACAGAGGTGTGGGTAGG - Intergenic
940322671 2:152393084-152393106 CTATTTACAAAGATGAGGGAAGG - Intronic
940402988 2:153268206-153268228 CTAGATACAATGGTGGGGGGTGG + Intergenic
940943575 2:159590728-159590750 CTAATTGCAAAGATGGGGGTGGG + Intronic
941065655 2:160899723-160899745 CTATTCACAGAGGTGTGGGTAGG + Intergenic
941815127 2:169788448-169788470 CTTTTTACAAAGGTGTGGGAAGG - Intergenic
943748242 2:191484622-191484644 CTACTTACAAAGCTATGGGCAGG - Intergenic
944442932 2:199761044-199761066 CTACTTACAGAGGCGTGGGCTGG - Intronic
945442378 2:209895428-209895450 CTATTTTCAAAGGCGAGGGTGGG - Intronic
946048456 2:216840992-216841014 CTACTTTCAAAGGTGTGGACAGG + Intergenic
946952076 2:224887149-224887171 CCACCTACAAATGTGGGGGAAGG - Intronic
1169875990 20:10297504-10297526 CTACTTACAGAGGGGTGGGCAGG + Intronic
1170243260 20:14193483-14193505 CTACTTACAAAGGAATGGGCAGG + Intronic
1170316328 20:15044770-15044792 CTATTTACAAAGATGTGGGAAGG - Intronic
1170317276 20:15056132-15056154 CTGCATACAGAGGAGGGGGTCGG - Intronic
1171875399 20:30570608-30570630 CTTTTTAAAAAAGTGGGGGTGGG + Intergenic
1172423185 20:34835118-34835140 ATACACAAAAAGGTGGGGGTGGG + Intergenic
1173311954 20:41904650-41904672 CCATTTGCAAAGGTGGGGGCAGG - Intergenic
1174455887 20:50648506-50648528 CCACTGACCAGGGTGGGGGTTGG + Intronic
1176031284 20:63014017-63014039 CAACTCAAAATGGTGGGGGTCGG + Intergenic
1179019020 21:37621375-37621397 CTGCTTACAAAGGTGGGAACTGG - Exonic
1179076195 21:38123835-38123857 CTATTTACACAGGTGTGGGTGGG - Intronic
1179648555 21:42791596-42791618 CTATTTACAAAGCTGTGGGCAGG - Intergenic
1181616504 22:24058544-24058566 CTCCTCACAAAGCTGTGGGTGGG - Intronic
950813763 3:15676120-15676142 CTAATAACAAAGATGGGGGCAGG + Intronic
951542837 3:23798559-23798581 TTCCTTACAATGCTGGGGGTTGG + Intergenic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
955665870 3:61348678-61348700 CTAGTTACAAAGGTGTAGATTGG + Intergenic
956718362 3:72098061-72098083 CTATTGACAAAGGTGTGGGCAGG + Intergenic
957037804 3:75311250-75311272 CTCTTTACAAAGGTGTGGGGAGG + Intergenic
959855508 3:111151565-111151587 CTACTTACAGAGGTGGGGAAAGG - Intronic
960743237 3:120857498-120857520 CTATTCACAAAGGTCTGGGTGGG - Intergenic
961085795 3:124066485-124066507 CTCTTTACAAAGGTGTGGGGAGG + Intergenic
962583322 3:136818147-136818169 CTATTTAAAAAGGTGTGGATGGG + Intergenic
963202216 3:142597364-142597386 CTGATTACAAAGGTGGTGGGGGG - Intronic
965423441 3:168491068-168491090 CTACTGATAAAGGAGAGGGTTGG + Intergenic
969183496 4:5459286-5459308 ATACTTAGAAAGGTGGGGGGGGG - Intronic
970223627 4:13835236-13835258 CTACTTACAAAGCTGGGAGCAGG + Intergenic
972109420 4:35538978-35539000 CTACTTACAGGGATGGGGTTGGG - Intergenic
972850582 4:43044887-43044909 CTACTTAGAAAAGTGGGGGGAGG - Intergenic
974024454 4:56720952-56720974 AGTCATACAAAGGTGGGGGTTGG + Intergenic
975815153 4:78209572-78209594 CTATTGACAGAGGTGTGGGTAGG - Intronic
976255282 4:83093486-83093508 CTAATTATAAAGGTGTGGGTGGG - Exonic
976398046 4:84578835-84578857 CAACTTCTAAAGCTGGGGGTGGG - Intergenic
977586799 4:98783427-98783449 CTACTTACAAAGGTGGGTGGGGG + Intergenic
978334269 4:107648876-107648898 CTGCTTAAGAAGGTGGGGGGTGG + Intronic
978673433 4:111279536-111279558 TTCTTTAAAAAGGTGGGGGTTGG - Intergenic
979466956 4:121050934-121050956 ATACTTACAAAGGTAGAGATGGG + Intronic
980182102 4:129414064-129414086 CTACTTGCAAAGGTGTGGGAAGG + Intergenic
982095600 4:151919205-151919227 CTACTTATAATTGGGGGGGTGGG - Intergenic
982401427 4:154972218-154972240 CTATTTACAGAGGTGTGGGCGGG + Intergenic
986182579 5:5407357-5407379 CTACTTAAAATGGTTAGGGTGGG - Intergenic
986719881 5:10553394-10553416 CTACTTAAAAATGCGGGTGTCGG - Intergenic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
988011542 5:25493493-25493515 TTAGTTACAAACTTGGGGGTGGG - Intergenic
988693923 5:33599640-33599662 CTACTTTCAAAGGTATGGGTAGG - Intronic
989392664 5:40918246-40918268 CTACTCACAAAGGCTGAGGTGGG + Intronic
989472352 5:41835078-41835100 AGACTAACAACGGTGGGGGTGGG + Intronic
989511207 5:42289580-42289602 CTACTTACAAAATTGGCAGTGGG - Intergenic
990843717 5:60112953-60112975 CTGCTTTCAAGGGTGAGGGTTGG + Intronic
991647829 5:68818982-68819004 CTATTTACAAAGGTATGGGCAGG + Intergenic
991670282 5:69040477-69040499 CTAATTACAAAGGGGTGAGTGGG + Intergenic
994722204 5:103393188-103393210 ATAGATAAAAAGGTGGGGGTGGG + Intergenic
995778566 5:115751697-115751719 CTCTTTAAAATGGTGGGGGTGGG - Intergenic
996370930 5:122751775-122751797 CTATTTACAGAGGTGTAGGTAGG - Intergenic
997256262 5:132430431-132430453 CTGTTTACAAAGGTGTGGGGAGG - Intronic
998087251 5:139336552-139336574 CTAAAAAAAAAGGTGGGGGTGGG - Intergenic
998427142 5:142038493-142038515 CTACTTACAATGCTTGAGGTAGG - Intergenic
1002009275 5:176264147-176264169 CTACTCCCACAGGTGGGAGTTGG + Intronic
1002217448 5:177648136-177648158 CTACTCCCACAGGTGGGAGTTGG - Intergenic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG + Intergenic
1004165688 6:13254677-13254699 CTAATTATAAAGGTGTGGGCAGG + Intronic
1004594589 6:17087040-17087062 CTAAAGACAAAGGTGTGGGTGGG - Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1006099241 6:31675890-31675912 GGACTTAGCAAGGTGGGGGTTGG - Intergenic
1007364866 6:41384276-41384298 CTATTTACAAAGGTGTGGACAGG + Intergenic
1007752914 6:44081027-44081049 CTCCTGACAAAGGCTGGGGTAGG - Intergenic
1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG + Intronic
1009907271 6:69885183-69885205 CAACTTACAGAGGTGGTGGGGGG - Intronic
1010274770 6:73956671-73956693 CTACTTACAAAATTGTGTGTAGG - Intergenic
1010410373 6:75554691-75554713 ATATTTACAAAGGTGTGGCTGGG - Intergenic
1010756653 6:79673132-79673154 CTTCTTGCAAGGGTGAGGGTGGG + Intronic
1010979113 6:82349866-82349888 CTTGTTAGAAAGATGGGGGTGGG + Intergenic
1011273305 6:85602324-85602346 ATACTTACAAAGGTATAGGTTGG - Intronic
1011812969 6:91154391-91154413 TTATTTAAAAGGGTGGGGGTGGG + Intergenic
1011870910 6:91891417-91891439 TTATTTACAAAGGTGAGGGCAGG + Intergenic
1011900713 6:92292370-92292392 CTATTTACAAAGGTGGGATTGGG - Intergenic
1012860681 6:104555694-104555716 CTAATTATAAAGGTGTGAGTAGG - Intergenic
1013455585 6:110326624-110326646 CTATTTACAAAGGTGTGGGCAGG + Intronic
1015042420 6:128738290-128738312 CTACAGAAAAAGGTGGGGGAAGG + Intergenic
1016297309 6:142587145-142587167 TTCCTTAGAAAGGTGGGAGTGGG - Intergenic
1017585123 6:155912006-155912028 CTGCTTAAAAATGTGGGAGTAGG + Intergenic
1022941808 7:35249077-35249099 CTAGGTGAAAAGGTGGGGGTGGG + Intronic
1023432907 7:40113131-40113153 CCACTTAAAATGGTGGTGGTAGG + Intergenic
1026665996 7:72340317-72340339 ATACTTTGGAAGGTGGGGGTGGG - Intronic
1028019152 7:85749490-85749512 CACCTAACAATGGTGGGGGTAGG - Intergenic
1028851799 7:95546081-95546103 CTAGTTACAAAGGTGGGAACTGG - Intergenic
1029349359 7:100002186-100002208 CAACTAAGAAAGGTGGGGGCGGG - Intergenic
1029601821 7:101569127-101569149 CTATTTTCAAAGGTGTGGGTGGG + Intergenic
1030305927 7:108018858-108018880 CTATTTACAAAGATATGGGTAGG - Intergenic
1031123303 7:117745250-117745272 CTACTTTCAAAGGTGGGGAAAGG - Intronic
1031997139 7:128240537-128240559 CTACGTACAAAGTGGGGGTTGGG - Intergenic
1033160918 7:138995772-138995794 CTATTTATAAAGGTGTGGGCAGG - Intergenic
1033952936 7:146807861-146807883 TTACTTACAAAGGAAGGAGTGGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034538460 7:151740462-151740484 CTACTTTCAAAGGTGTGGGCAGG - Intronic
1034912621 7:155009695-155009717 CTACTTACAAAGGTGTAGGCAGG - Intergenic
1035366828 7:158353913-158353935 CCAGAGACAAAGGTGGGGGTGGG + Intronic
1036585526 8:10119867-10119889 CTATTTACAAAGGTGTGGTCAGG + Intronic
1038084588 8:24180519-24180541 CCACCTAAGAAGGTGGGGGTGGG + Intergenic
1038974507 8:32678285-32678307 CTACTTAAAAAGGACAGGGTGGG + Intronic
1042172730 8:66008218-66008240 CTACTTACAAAGATGAGGGTGGG - Intergenic
1042373249 8:68017276-68017298 CTTCTTAAAAGGCTGGGGGTGGG + Intronic
1045574817 8:103409078-103409100 CTAATTACAAAGGTGTGAGCAGG + Intronic
1047233161 8:123015026-123015048 CTAGTTGCAAATGTGGGGGTTGG + Exonic
1047385666 8:124406941-124406963 CTACCTACATTGGTGAGGGTGGG - Intergenic
1048206179 8:132417166-132417188 CTATTTACAAAGGTGAGGAAAGG + Intronic
1048473493 8:134723372-134723394 CTCTTTACAAAGGTGTGGGCAGG + Intergenic
1049642206 8:143720829-143720851 CTACGTGCAGAGGTGGGGGTGGG + Exonic
1051357402 9:16252588-16252610 CAACTTAAAAAGTTGGTGGTGGG + Intronic
1051444918 9:17129684-17129706 CTAATTACAAAGGTAAGAGTAGG - Intergenic
1052342899 9:27380682-27380704 TGATTTACAAGGGTGGGGGTGGG - Intronic
1052892591 9:33717929-33717951 CCACTTACAATGGTGGGGTAGGG + Intergenic
1053197097 9:36127773-36127795 CTATTTATAAAGGTGTGGGCAGG + Intergenic
1055967850 9:81882717-81882739 CTGTTTACAAAGATGTGGGTGGG - Intergenic
1057258525 9:93569826-93569848 GAACTTACATGGGTGGGGGTAGG + Intergenic
1058051196 9:100408800-100408822 CTATTTACAAAGGAGTGGGCAGG + Intergenic
1059948563 9:119438298-119438320 CTACTGACAAAGGTGTGGAGAGG - Intergenic
1186330236 X:8524807-8524829 CAAATCACTAAGGTGGGGGTGGG - Intergenic
1187635688 X:21225690-21225712 CTACTTACAGATGTGTGGCTAGG + Intergenic
1187967335 X:24624876-24624898 ATACTTACAAAGGTATGGGCAGG - Intronic
1188236686 X:27740132-27740154 CTCCTTACAAAGGTGAGAGCAGG - Intronic
1188379247 X:29471156-29471178 CTTTTTCCAAAGGAGGGGGTGGG + Intronic
1188513885 X:30964639-30964661 CGATTTACAAAGGTGTGGGCAGG + Intronic
1189236828 X:39493580-39493602 ATACTCACAAATGTGGAGGTTGG - Intergenic
1189680294 X:43508878-43508900 CTATTTATAAAGATGTGGGTGGG - Intergenic
1193150392 X:78118621-78118643 CTACATACAGAGGTGTGGGTAGG + Intronic
1193279249 X:79627686-79627708 CTTCTTACATAGATGGTGGTAGG - Intergenic
1194383021 X:93218982-93219004 CTAATTACAAAGGTATGGATGGG + Intergenic
1194750048 X:97673837-97673859 CTCATTACCAAGGTGGGGGTGGG - Intergenic
1195033181 X:100946516-100946538 CTATCTACAAAGGTGTGGGCAGG + Intergenic
1197137805 X:123083275-123083297 CTAATTAAAAAGGTGCGGGTGGG - Intergenic
1198507202 X:137312635-137312657 CTACTTACAAAGGTGTTTGTTGG + Intergenic
1198609218 X:138379070-138379092 CTATTTACAAAAGTGTGGCTAGG - Intergenic
1198643113 X:138778025-138778047 CTTATTGAAAAGGTGGGGGTAGG + Intronic
1200880698 Y:8208992-8209014 CCAATTACAAATGTGGAGGTGGG + Intergenic
1201575509 Y:15457408-15457430 GTACTTAGAGAGGTGGAGGTGGG + Intergenic