ID: 936207130

View in Genome Browser
Species Human (GRCh38)
Location 2:110462689-110462711
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 3, 1: 0, 2: 3, 3: 28, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936207130 Original CRISPR CACAGGGAAATGTCTGAGAA AGG (reversed) Intronic
900076959 1:825696-825718 CACAGGGTCATGGGTGAGAATGG + Intergenic
901174468 1:7288889-7288911 TACAGAGAAATGCCTGAGATTGG + Intronic
903413242 1:23164163-23164185 CCCATGGATTTGTCTGAGAATGG - Intronic
903548029 1:24138931-24138953 CAAAGCAAAATGGCTGAGAATGG - Intronic
903623274 1:24713563-24713585 CCCAGGAAAATGTGTGAGCAAGG - Intergenic
903776354 1:25796584-25796606 CACAAGGTAATTTCAGAGAAAGG - Intergenic
904172810 1:28603516-28603538 CACACGGAAAGGTCAGGGAATGG - Exonic
904842830 1:33384603-33384625 CAGAGGGAAAGGTCTGGGCAAGG - Intronic
904948960 1:34220583-34220605 CACATGGAAATGCCTGCCAAAGG + Intergenic
906795413 1:48692812-48692834 CACAGGGAAATGGATTAGGAGGG + Intronic
907419969 1:54340659-54340681 CCCAGGGAAATGACTGATAAGGG + Intronic
907999488 1:59666329-59666351 CACATGGTGATGTTTGAGAAAGG - Intronic
908195844 1:61744988-61745010 CACAGGGTGAGGTATGAGAAGGG + Intronic
909276872 1:73698204-73698226 AACAGGGAAATGTTTCAAAAGGG - Intergenic
909440471 1:75690450-75690472 CAGATGGAAATCTCTGAGAGGGG + Intergenic
910297272 1:85661889-85661911 CAAGAGGAAATGTCTAAGAAGGG - Intronic
910745869 1:90574343-90574365 CAGAGCAAAATATCTGAGAAAGG + Intergenic
912419179 1:109531853-109531875 GACTGGGAAAAGACTGAGAAAGG - Intergenic
913215941 1:116620479-116620501 CATAGGGCAAGGTCTGAGAGGGG - Intronic
913936277 1:125053316-125053338 CACAAAGAAGTTTCTGAGAACGG - Intergenic
914355363 1:146879988-146880010 CACAGGGAAGGCTCTTAGAATGG - Intergenic
915737222 1:158092729-158092751 CACAGGGAAAGATCTCAGAGGGG + Intronic
916979224 1:170115607-170115629 CACAGCGACATGCCTGAGACAGG - Intergenic
917194887 1:172454716-172454738 GAGAGGGAAGGGTCTGAGAAGGG - Intronic
917234491 1:172876098-172876120 CACAAGGAGATGTCTGTCAAAGG - Intergenic
917404506 1:174690045-174690067 CACAGGGAGATGTTGGAAAATGG - Intronic
918439244 1:184549568-184549590 CATAGGGAAAAGTATGAGTAAGG - Intronic
919396520 1:197056510-197056532 ACCAGGGACATGTCTCAGAAGGG + Intronic
919736310 1:200954054-200954076 CTCAGGGAAGTGTGAGAGAACGG + Intergenic
920257516 1:204665584-204665606 CACAGGGCACTCTCTGTGAAAGG + Intronic
921063146 1:211603191-211603213 CAGAGGGAATTTTCTGAGAAAGG - Intergenic
921524085 1:216195460-216195482 CACAGGGTCATCTCTGACAAGGG - Intronic
922353549 1:224755699-224755721 CACAGGAAAATGTCTGACTCAGG - Intergenic
923360003 1:233201711-233201733 CACAGGGAAAAGTCTAGGTATGG + Intronic
923513901 1:234677380-234677402 CACACAGAAAGGTTTGAGAAAGG + Intergenic
924949997 1:248873575-248873597 CGCAGGACAATGCCTGAGAAAGG - Intergenic
1064221957 10:13448646-13448668 CAAAGAGAAATCACTGAGAAGGG + Intronic
1064791992 10:18968072-18968094 CACTGGAAAATGTTTGAAAAGGG + Intergenic
1065268237 10:23999572-23999594 CGGAGGGAAACGTCTGAGAAGGG + Intronic
1065677021 10:28187237-28187259 CTCAAGGAAATCTCTGAAAAGGG + Intronic
1065861550 10:29876504-29876526 TAAAGGGAACTGACTGAGAATGG + Intergenic
1066473917 10:35725919-35725941 CACTGGGAGATCTCTGGGAAAGG + Intergenic
1066706331 10:38183044-38183066 CACAGGGAAAAGGGTGGGAAGGG - Intergenic
1067557392 10:47282467-47282489 AACAGCTAAATGTCAGAGAAGGG + Intergenic
1071952205 10:90716792-90716814 TAAAGGGGAATGTCAGAGAAAGG - Intergenic
1073622770 10:105066239-105066261 CACAGGGAAATATTTCAGGAGGG - Intronic
1074196511 10:111191680-111191702 CACAGGCAAATGTATTGGAAGGG - Intergenic
1075811167 10:125226244-125226266 CACAGAGAAAGGGCTGAAAAGGG - Intergenic
1077923629 11:6659438-6659460 CAGAGGGAAAAGTTAGAGAAAGG + Intergenic
1078689168 11:13561762-13561784 TAAAGGGAAATTGCTGAGAAGGG - Intergenic
1079650221 11:22919207-22919229 CACATGTAAATGTATGAGAAAGG + Intergenic
1080337025 11:31209344-31209366 CACAAGGAATAGTCTGAGAGGGG + Intronic
1080382437 11:31787517-31787539 CTGAGGGAACTGTCAGAGAAGGG - Exonic
1082009223 11:47438995-47439017 GACAGGGAAGTGGCTGAGACCGG - Intronic
1082157261 11:48839131-48839153 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1082159315 11:48868968-48868990 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1082316504 11:50731358-50731380 CACAAGGAAGTTTCTGAGAATGG + Intergenic
1082522985 11:53996867-53996889 CACAGGAAACATTCTGAGAATGG - Intergenic
1082607307 11:55256362-55256384 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1085060629 11:73443136-73443158 CACTGGGAAAGGGCTAAGAAAGG - Intronic
1086235873 11:84629734-84629756 CAAGGGGATATGACTGAGAAAGG + Intronic
1087310453 11:96535910-96535932 AGCAGGGAAATGGCAGAGAATGG - Intergenic
1089391368 11:118104280-118104302 CCTGGGGAAATGTCTGAGAGAGG - Intronic
1090756826 11:129798989-129799011 CTCAAGGAAATGCCAGAGAAAGG + Intergenic
1092109138 12:5946379-5946401 CATAGGGAAAGCACTGAGAAGGG - Intergenic
1092711414 12:11341404-11341426 CCTAGGAAAATGTCAGAGAAAGG - Intergenic
1093799003 12:23348954-23348976 GACAGGGAATTGCCTGAGAATGG + Intergenic
1093908306 12:24717623-24717645 AATAGGGTAATGTCTGTGAAAGG - Intergenic
1094878791 12:34687953-34687975 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1094878977 12:34691734-34691756 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1095031707 12:37293642-37293664 CACAAAGAATTTTCTGAGAATGG - Intergenic
1095050984 12:37554228-37554250 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1095119507 12:38399969-38399991 CTCTGTGAAATGTCTAAGAAAGG + Intergenic
1095654835 12:44657018-44657040 CACAGAGCAATGTTTGAGAAAGG + Intronic
1095727951 12:45473126-45473148 CATAAGGAAATATCTGAGACTGG - Intergenic
1095909380 12:47410474-47410496 CCCAGGGAAATGTCTGGGTAGGG - Intergenic
1096141171 12:49243769-49243791 TAAAGGGAACTGCCTGAGAATGG - Intronic
1098233183 12:68393525-68393547 CACAGGGAATGGTGTGAGAGAGG - Intergenic
1098675072 12:73279670-73279692 TACAGGGAAATACCTGAGACTGG - Intergenic
1099147342 12:79063487-79063509 CACAGTGGAATGTCTTTGAAAGG - Intronic
1100159997 12:91846901-91846923 CACAGAGATCTGTGTGAGAAGGG - Intergenic
1100444213 12:94646208-94646230 TCCAGAGAAATGTCAGAGAAAGG + Intronic
1100619910 12:96261032-96261054 CACAAAGAGAAGTCTGAGAAAGG + Intronic
1100794306 12:98164263-98164285 CACAGGGCAAGGAGTGAGAAGGG + Intergenic
1104770535 12:131360106-131360128 CACAGTCAAATGTCTGACAAGGG + Intergenic
1104945968 12:132415016-132415038 CACAGGGACAGTTCTGGGAAGGG + Intergenic
1105129405 13:16916977-16916999 CACAAGGAAGTTTCTGAGAATGG - Intergenic
1105219676 13:18313958-18313980 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1106079598 13:26489169-26489191 CTTAGGGAAATGAGTGAGAATGG - Intergenic
1106194554 13:27482057-27482079 TAGAGGGCAATGTCTGAGCATGG - Intergenic
1108023086 13:46149374-46149396 TACAGTGAAAAGTCAGAGAAGGG - Intronic
1108696349 13:52905844-52905866 GAGAGGGAAATGTGAGAGAAAGG - Intergenic
1109830323 13:67777983-67778005 GAGAGGCAAATGTTTGAGAAAGG + Intergenic
1110495013 13:76158082-76158104 CAAAGGGAATTGACTGACAAAGG - Intergenic
1110583567 13:77160830-77160852 CAGATGGAAAGGTCTTAGAATGG - Intronic
1112314962 13:98352464-98352486 CAGAGAGAAATGACAGAGAAGGG + Intronic
1112588477 13:100741335-100741357 CACAGCAAAATTTCTAAGAAAGG - Intergenic
1112589722 13:100751889-100751911 CACAGGGATGTGTCTGTGGAGGG - Intergenic
1112941926 13:104873787-104873809 CACTTGGAAACTTCTGAGAATGG + Intergenic
1113870627 13:113557688-113557710 CACAGGCAAATGCCTGACTAGGG - Intergenic
1114761745 14:25323594-25323616 CACATAGCAATGTCAGAGAATGG + Intergenic
1114772772 14:25447486-25447508 CACAGGAAAATGTTAGTGAATGG + Intergenic
1115445080 14:33480586-33480608 CACAGGGACAGGTGGGAGAAAGG - Intronic
1117313467 14:54551201-54551223 AACACTGAAATCTCTGAGAAGGG - Intergenic
1117328185 14:54687910-54687932 CAGAGGGTGATGCCTGAGAAGGG - Intronic
1117580572 14:57147549-57147571 CATAGAGAACAGTCTGAGAAAGG + Intergenic
1117782848 14:59252622-59252644 CACACAGGAATGTCAGAGAAAGG + Intronic
1119572550 14:75688407-75688429 CACAGGGCGAGGTATGAGAAAGG - Intronic
1120044967 14:79795414-79795436 CACAGAGAAATGTGGGAGGATGG - Intronic
1121176606 14:91895282-91895304 CAAAGGGAAATGGCCAAGAAGGG + Intronic
1121678404 14:95772918-95772940 GACAGGGAGATTTATGAGAAAGG - Intergenic
1123968269 15:25480416-25480438 GAAAGGGAAATGTGGGAGAAAGG + Intergenic
1124019548 15:25906932-25906954 CATTGAGAAATGTCTCAGAAAGG + Intergenic
1125304310 15:38292287-38292309 GACAGGAAAATGTGGGAGAATGG - Intronic
1126510291 15:49463710-49463732 CAGAAGGAACTGTGTGAGAAAGG - Intronic
1126717934 15:51541726-51541748 TACATGGAAATGTAGGAGAAAGG - Intronic
1130097671 15:80867928-80867950 TACTGGGCAATGTCAGAGAAGGG + Intronic
1131032292 15:89196301-89196323 CACAGTGTGATGTCTCAGAAGGG + Exonic
1131502641 15:92984292-92984314 AATAGGGAAATGTCAGACAATGG + Intronic
1132226090 15:100142403-100142425 CACAGGGAAAGATATGGGAAGGG + Intronic
1132899067 16:2243592-2243614 CACTGGGAAATGGATGAGGAAGG + Intronic
1133056961 16:3150181-3150203 CACAGGGACATGTCTGGGAGAGG - Intergenic
1133373151 16:5261520-5261542 CACAGTGAAATGTCAGTGGATGG - Intergenic
1133506676 16:6419006-6419028 CACAGTGAAAAGTCTGCAAATGG - Intronic
1134253578 16:12592402-12592424 CGCAGCTAAATATCTGAGAACGG + Intergenic
1134754361 16:16653053-16653075 GACAGGGAACTCTCTGAGGATGG + Intergenic
1135175211 16:20221746-20221768 CAGAGGGAAATGACAGAGAGAGG - Intergenic
1135260026 16:20972716-20972738 CACGGGGCATTGTCTCAGAAGGG - Intronic
1137339881 16:47591229-47591251 GACAGGGAAAGGGCTGAGGAAGG - Intronic
1138914006 16:61440580-61440602 CACAGTGAAAAACCTGAGAAAGG + Intergenic
1139225003 16:65226148-65226170 CATTGGGCAATGTATGAGAAAGG - Intergenic
1140117651 16:72056672-72056694 ATCATGGAAATGTCAGAGAAGGG - Intronic
1140117868 16:72058396-72058418 ATCATGGAAATGTCAGAGAAGGG - Intronic
1140305919 16:73802550-73802572 CTCAGGGAAAAGAATGAGAAAGG + Intergenic
1140489255 16:75320496-75320518 CACAGGGAAAAATCAAAGAATGG - Intronic
1140959717 16:79900186-79900208 CTCAGGGAAATGGCTGACATTGG + Intergenic
1141706487 16:85668073-85668095 CACAGGGTGCTGTCTCAGAAGGG - Intronic
1142362264 16:89633042-89633064 CCCAGGCTAATGTCTGAGATGGG + Intronic
1142409986 16:89911051-89911073 CAAGGGGACATGTCTGAGAAGGG - Intronic
1144519076 17:15942478-15942500 TATAGGGAAATATCTGAGACTGG - Intergenic
1144669242 17:17123213-17123235 CAAAGGGAAGTGACTGCGAATGG + Intronic
1145237785 17:21221253-21221275 CCCAGGGAGATGGATGAGAATGG + Intergenic
1145417709 17:22736034-22736056 CACAAGGAAGTTTCTCAGAAAGG - Intergenic
1145418421 17:22743612-22743634 CACAGGGAAGATTCTCAGAAAGG - Intergenic
1145457658 17:23344187-23344209 CACAAAGAATTTTCTGAGAAAGG - Intergenic
1145671265 17:26450363-26450385 CACAGAGAAGTTTCTGAGAAAGG - Intergenic
1145686341 17:26670560-26670582 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1145687968 17:26695465-26695487 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1149041250 17:52191539-52191561 CATAGGTAAAATTCTGAGAAGGG - Intergenic
1149481343 17:57005765-57005787 AATAGAGAAATGGCTGAGAAGGG - Intronic
1149615290 17:57992357-57992379 GACAGGGTAATGGCTGAGCATGG + Intronic
1152995034 18:398618-398640 CACAGGGAAATCTCACAGATGGG + Intronic
1153028223 18:690071-690093 CACAGGGCAAGGTGTGAGGAGGG - Intronic
1154558093 18:15784779-15784801 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1154602777 18:16399865-16399887 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154632506 18:16808421-16808443 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154685260 18:17530867-17530889 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154715103 18:17940535-17940557 CACAAAGAACTTTCTGAGAATGG - Intergenic
1154754890 18:18485947-18485969 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1154905738 18:20562182-20562204 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1154911052 18:20651579-20651601 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1155898996 18:31364407-31364429 TACAGGGAAATGTTCAAGAAAGG - Intergenic
1156178187 18:34572281-34572303 AACAGTGGAAAGTCTGAGAAAGG - Intronic
1156652207 18:39237885-39237907 CACATGGGAAGGGCTGAGAAAGG - Intergenic
1158030238 18:52954559-52954581 CGTAGGGAAATATTTGAGAAAGG + Intronic
1158187419 18:54786165-54786187 GTTAGTGAAATGTCTGAGAAAGG + Intronic
1160348790 18:78156219-78156241 CACAAGGAAAGGACTGACAATGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161126732 19:2562042-2562064 CTCAGAGAAATGTCGGAGGAAGG - Intronic
1162327335 19:10006963-10006985 CAGAGGGCAAAGTCTGAGAGAGG - Intronic
1162343301 19:10105385-10105407 CATAGGGAGATGGCAGAGAAAGG + Intergenic
1162958546 19:14113129-14113151 CACAGGGCAAGGTTTGAGAGAGG - Intronic
1163068848 19:14820909-14820931 CACAAGGAAAAGTGAGAGAAAGG + Intronic
1163881200 19:19923930-19923952 CACTGGGAATTGTCGGACAAGGG - Intronic
1164357040 19:27448619-27448641 CACAAAGAAGTTTCTGAGAAAGG - Intergenic
1167933156 19:52884768-52884790 AACAGTGAAATGACAGAGAAAGG + Intronic
1167944113 19:52973713-52973735 GACAGTGAAATGCCTGAGACAGG + Intergenic
1167989662 19:53347726-53347748 GACAGTGAAATGACTGAGACAGG - Intronic
1167993159 19:53377998-53378020 GACAGTGAAATGACTGAGACAGG - Intronic
1168001737 19:53452023-53452045 GACAGTGAAATGACTGAGACAGG - Intronic
1202674106 1_KI270710v1_random:24790-24812 AACAGAGAAATGTCTGATATTGG - Intergenic
926091773 2:10055870-10055892 CAGAGGAAAGTGTCTTAGAAAGG + Intergenic
926436892 2:12847345-12847367 GACTGGGAAACGTCTAAGAATGG + Intergenic
926641921 2:15246216-15246238 CACAGGCAAAGGCCTAAGAAAGG - Intronic
928381404 2:30821756-30821778 CAGAGGGTACGGTCTGAGAACGG - Intergenic
929674745 2:43915381-43915403 CAAAGGAAAATGCCTCAGAATGG + Intronic
930399693 2:50867393-50867415 TACAGGGAAATGGTTGAGAGGGG + Intronic
931168591 2:59778046-59778068 AACAGGGTAATGTTTGATAAAGG - Intergenic
931653825 2:64491932-64491954 AAATGGGAAAAGTCTGAGAAAGG + Intergenic
932127914 2:69161225-69161247 CACATGGTAATGTGAGAGAATGG - Intronic
933457559 2:82535935-82535957 CACAGGGAATAGTTTGAAAATGG - Intergenic
933553829 2:83807834-83807856 CACAGGGCGATGTATGGGAAAGG + Intergenic
934184372 2:89658561-89658583 CATAGGGCAAGGTCTGAGAGGGG + Intergenic
934294657 2:91732699-91732721 CATAGGGCAAAGTCTGAGAGGGG + Intergenic
934575301 2:95396823-95396845 CACAGGGAAATGGCCCAGAGAGG + Intergenic
934738795 2:96704182-96704204 GCCAGGGAGATGTCAGAGAATGG - Intergenic
935095718 2:99942564-99942586 CACAGGGAATGGCCTGTGAAGGG + Intronic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
936475414 2:112835500-112835522 CACAGGGAAAGCTCAAAGAAGGG - Intronic
939024291 2:136993774-136993796 GACAGGGAAATGTATGAAACCGG + Intronic
939305373 2:140403333-140403355 CCCAAGGAAATGCCAGAGAAAGG + Intronic
941480658 2:166005844-166005866 TGAAAGGAAATGTCTGAGAAAGG + Intronic
941662787 2:168212512-168212534 CTCAGTTAAATGTCTGAAAAGGG + Intronic
941906938 2:170725811-170725833 CACAGGGAAATGTAGGAGCCTGG + Intergenic
943779961 2:191812624-191812646 CACAGTGAAATGTGGGAGAGTGG + Intergenic
944536549 2:200716192-200716214 CTCAGGGAAATGTGAGGGAAGGG + Intergenic
944554246 2:200872279-200872301 CATAGGGCAAAGTCTGAGAGAGG + Intronic
947076407 2:226350361-226350383 TTCAGGGAAATGTCTCTGAAGGG + Intergenic
947849825 2:233276845-233276867 CACAGGGAAATTTCTAATACTGG - Intronic
948201341 2:236131586-236131608 CAAAGTGAAATGTCTGTCAATGG - Exonic
948396081 2:237646308-237646330 CACAGGTAAATGTGTGCCAAGGG + Intronic
948398331 2:237663817-237663839 CACAGGGAAAGGTCTGGCAAAGG + Intronic
1168806248 20:673976-673998 CCCAGGGACATGGCTGAGCAGGG - Intronic
1169958824 20:11135828-11135850 GCCAGGGAAATGTCTAAGGAGGG - Intergenic
1170169149 20:13392286-13392308 CACAGAGAGATGTATGAGCAGGG - Intronic
1171545515 20:25997682-25997704 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1171573931 20:26280951-26280973 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171575319 20:26305226-26305248 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171575930 20:26317058-26317080 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576005 20:26318594-26318616 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576064 20:26319790-26319812 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171576711 20:26333992-26334014 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171595465 20:26668854-26668876 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171597104 20:26693329-26693351 CACAAATAAATTTCTGAGAATGG - Intergenic
1171662517 20:27673977-27673999 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171665818 20:27723778-27723800 CACAAATAAATTTCTGAGAATGG - Intergenic
1171677853 20:27904162-27904184 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171694106 20:28147370-28147392 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171694464 20:28152639-28152661 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1171808261 20:29709963-29709985 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1171836398 20:30155192-30155214 CACAAAGAAGTTTCTGAGAATGG + Intergenic
1173673730 20:44815868-44815890 CAAAGGAAGATGGCTGAGAAAGG + Intergenic
1175593076 20:60208982-60209004 CACAGGCAAAGGTCCGGGAAGGG + Intergenic
1176476170 21:7211605-7211627 CACAAGGAAGTTTCTCAGAATGG + Intergenic
1178404241 21:32311543-32311565 CACAGGCAAATTCCTGAGAAGGG - Exonic
1179272835 21:39865003-39865025 CACAGAGAAATTTCAGGGAAAGG - Intergenic
1179708464 21:43195763-43195785 CACGGGGGAATGTATTAGAAAGG + Intergenic
1180226712 21:46397802-46397824 CACAGAGGAACGTCTGAGACTGG - Intronic
1180403402 22:12517892-12517914 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1180817277 22:18798846-18798868 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1181203467 22:21233167-21233189 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
1181507246 22:23367953-23367975 CTCAGGGAGACATCTGAGAAAGG - Intergenic
1182204349 22:28608735-28608757 CACAGGGAACTGTTTGGCAAAGG + Intronic
1182280448 22:29215180-29215202 CACAGGGGATAGGCTGAGAATGG - Intronic
1183778562 22:39983884-39983906 AACAGGGCAATGTCTGAGTGTGG + Intergenic
1203223454 22_KI270731v1_random:62247-62269 CATAGGGCAAGGTCTGAGAGGGG + Intergenic
1203267376 22_KI270734v1_random:24573-24595 CATAGGGCAAGGTCTGAGAGGGG - Intergenic
949113307 3:288739-288761 CACAGGGAATTGTCTGTGAAGGG + Intronic
949717775 3:6953179-6953201 CACTGGGAAATGACAGAGACAGG - Intronic
949832026 3:8225193-8225215 CACAGTGAAAAATCTGAGCAGGG + Intergenic
950162848 3:10772832-10772854 CCCAGGGGAATGTCGAAGAAAGG + Intergenic
950298782 3:11855803-11855825 CACAGTGCAAAGTATGAGAAAGG - Intergenic
950610165 3:14121564-14121586 CCCAGGGTCATGTTTGAGAATGG + Intronic
951275841 3:20684963-20684985 CACAGGGGAATTTCTGCAAATGG - Intergenic
952604685 3:35130912-35130934 CAAAGGGAAAACTCTGAGATGGG + Intergenic
953243822 3:41173018-41173040 CACATATTAATGTCTGAGAAAGG + Intergenic
955729569 3:61970373-61970395 CACAGGGAAACATCTAAGGAGGG + Intronic
955943053 3:64164888-64164910 CACAGGGACTTTTCTGAGGATGG - Intronic
955959247 3:64322105-64322127 GAAAGGAAAATGACTGAGAATGG - Intronic
956358960 3:68425815-68425837 CTCAGGAACAGGTCTGAGAATGG - Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957347724 3:78983226-78983248 TAGAGCTAAATGTCTGAGAAAGG + Intronic
957548844 3:81677660-81677682 CACAGGGCAATATGTCAGAAAGG - Intronic
957574946 3:81995483-81995505 AACAGGGAAATGGCTGGCAAAGG - Intergenic
958031456 3:88115985-88116007 AACAGGGAAATGTGTGAGAGAGG + Intronic
958161299 3:89819049-89819071 AACAGGGAGATGCCAGAGAATGG + Intergenic
958205056 3:90380718-90380740 CACAAGGAAGTTTCTGAGAATGG + Intergenic
958404612 3:93738581-93738603 CACAAAGAAGTTTCTGAGAATGG + Intergenic
958404843 3:93742826-93742848 CACAAAGAACTTTCTGAGAATGG + Intergenic
958407416 3:93766452-93766474 CACAAAGAAGTTTCTGAGAATGG + Intergenic
958408163 3:93774934-93774956 CACAAAGAAGTTTCTGAGAATGG + Intergenic
958928211 3:100181367-100181389 CACAGGGAAAGCTCAGGGAAGGG - Intergenic
959456802 3:106572772-106572794 GACAGGGAAATGTTGGATAAAGG + Intergenic
959813470 3:110647016-110647038 TTCATGGAAATGTCTGTGAATGG + Intergenic
961491519 3:127259621-127259643 CACAGGGAAATGAAACAGAAAGG - Intergenic
961800150 3:129441259-129441281 CACAGAGAAAGATCTCAGAAGGG - Intronic
962076234 3:132084742-132084764 CACCTGTAAATGCCTGAGAATGG - Intronic
963727301 3:148936865-148936887 CAAGGAGAAATGACTGAGAAAGG - Intergenic
964694193 3:159488538-159488560 CAGAGGGAAAGGTCTGAGGAGGG + Intronic
964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG + Intronic
966316048 3:178646293-178646315 AACAGGCAAATATCTGACAATGG + Intronic
967379983 3:188846771-188846793 CATAGGGGAATGACTGAGCATGG + Intronic
967674289 3:192277748-192277770 AACAGGGAAATGTATGTGTACGG - Intronic
967686693 3:192425402-192425424 CCCAGGAATAAGTCTGAGAAAGG + Intronic
967960236 3:194914606-194914628 GACTGAGAAATGTCTGTGAAAGG - Intergenic
968205121 3:196792959-196792981 CAGAGGGGAATCTGTGAGAAGGG + Intronic
968716464 4:2163544-2163566 CAGCGGGAAATGAGTGAGAAGGG - Intronic
969184743 4:5466879-5466901 CATAGGGAAATGACTGAGCCAGG + Intronic
969708620 4:8830152-8830174 CACAGGGAGGAGTTTGAGAAGGG + Intergenic
970636769 4:18020119-18020141 TATAGGAAAATGTATGAGAAAGG - Intronic
972075628 4:35082771-35082793 TACAGGTAAAATTCTGAGAAGGG + Intergenic
973459499 4:50621395-50621417 CACAAAGAAGTTTCTGAGAATGG - Intergenic
975279673 4:72546510-72546532 CACAGGGAAATCACTGAGCTAGG + Intronic
975286402 4:72626424-72626446 CTCAGGAAAATATCTGAGAGTGG - Intergenic
975573642 4:75841998-75842020 CACAGGGAAATGTTTGAAATAGG + Intergenic
976965609 4:91036699-91036721 AACAGAAAAATGTCTTAGAATGG + Intronic
978631353 4:110749701-110749723 CACAGGGAAAGGTTTAAGAAAGG - Intergenic
979075887 4:116269726-116269748 GACAGGGAAATAACTGTGAAAGG - Intergenic
981097139 4:140793335-140793357 CACAGGGAAGGGTGTGGGAAGGG - Intergenic
981174150 4:141661053-141661075 CACAGAGAAAATTATGAGAATGG + Intronic
984625224 4:181999354-181999376 CACAGGCAAAGTTCTGAGACTGG + Intergenic
984835658 4:184017898-184017920 CCCATGGAAGTGTGTGAGAAGGG + Exonic
986274967 5:6265757-6265779 GTCAGGGAAATGCCTGTGAAGGG - Intergenic
989684724 5:44072076-44072098 CACAGGCAAATTTATGACAATGG - Intergenic
990374903 5:55159653-55159675 AGCAGGGAAATATCTGAAAAAGG - Intronic
990567190 5:57041654-57041676 CACAGGGCAAGGTCTGGGGATGG + Intergenic
991008220 5:61853306-61853328 TACAGGGAAATATCTGAGGCTGG + Intergenic
991632348 5:68668954-68668976 CATAGATAAATGTCTGACAAAGG + Intergenic
992697835 5:79308117-79308139 CAAAGGGACATATCTGATAAAGG - Intronic
993395303 5:87379370-87379392 TACAGGAAAAGTTCTGAGAAAGG + Intronic
993627897 5:90247903-90247925 CAAATGGAATTGTCTAAGAATGG - Intergenic
994849789 5:105039269-105039291 TACAAGGAAATGTCTGACACTGG - Intergenic
995447004 5:112255517-112255539 TACAGGGTAAAGGCTGAGAATGG - Intronic
995480111 5:112584940-112584962 CCCAGGGAAATGCAGGAGAATGG + Intergenic
996129227 5:119761001-119761023 CACAGGGAAATTTAGGAGGAAGG - Intergenic
997943776 5:138181507-138181529 ATCAGGTAAGTGTCTGAGAAGGG + Exonic
998476433 5:142426281-142426303 AACAGGGGAATTTGTGAGAATGG - Intergenic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
999256206 5:150211190-150211212 CACAGGGAAATGTCAGACCCAGG - Intronic
999698593 5:154207667-154207689 GACAGGGAAATGGCTGGGCAGGG + Intronic
999857085 5:155606623-155606645 CCCAGGGGAATGTCAGAAAAGGG - Intergenic
1001157714 5:169287541-169287563 CAAAGGGAAATGCATTAGAAAGG - Intronic
1002364668 5:178700635-178700657 CACACTGGAATCTCTGAGAAGGG - Intergenic
1006283030 6:33071075-33071097 CACAGGGAAATCTGTGAGTTGGG - Intronic
1006951103 6:37821296-37821318 CACAGGGAAATTTTTGAGAAAGG - Intronic
1007530926 6:42541551-42541573 CACAGGGAAAAGAATGAGAGAGG + Intergenic
1007734207 6:43970593-43970615 CACAGGGGAATGTGGGAGAAAGG - Intergenic
1009254447 6:61365575-61365597 CACAAAGAAGTCTCTGAGAATGG - Intergenic
1009475643 6:64087779-64087801 CACCAGAAAATGTTTGAGAAAGG + Intronic
1012079571 6:94737991-94738013 CTCAAGGAAATATCAGAGAAAGG + Intergenic
1015297758 6:131617567-131617589 AACAGTAAAATGTCTGGGAAAGG + Intronic
1018035720 6:159879436-159879458 AAAAAAGAAATGTCTGAGAATGG + Intergenic
1018450668 6:163904361-163904383 CAAAGGGAAACAGCTGAGAAGGG - Intergenic
1018789928 6:167140538-167140560 CACAGAGAGATGACAGAGAAGGG + Intergenic
1019165692 6:170096268-170096290 CACTGGGAATGGTCTGAAAAAGG - Intergenic
1019383426 7:740181-740203 CAAAGGGCAATGCCTGAGACGGG - Intronic
1019869181 7:3742863-3742885 CACAGAGAAATATGTTAGAAAGG + Intronic
1020226682 7:6285742-6285764 CACAAGGAAGTGTGTGACAATGG + Intergenic
1020317914 7:6919675-6919697 CACTGGGGAATGTCAGCGAAGGG + Intergenic
1021210969 7:17851995-17852017 CACAGCAAAAAGACTGAGAAAGG + Intronic
1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG + Intergenic
1023217656 7:37882154-37882176 CACAGGCAAATTTCTAAGTAAGG - Intronic
1024778849 7:52822311-52822333 CACAGAGAGATGTCTGAAATTGG - Intergenic
1024830309 7:53446456-53446478 GACAAGGAAAAGTCAGAGAAGGG - Intergenic
1025296922 7:57782740-57782762 CCCAAAGAATTGTCTGAGAAAGG - Intergenic
1025314804 7:58007584-58007606 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025315774 7:58025978-58026000 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025473046 7:60882172-60882194 CACAATGAAGTTTCTGAGAATGG + Intergenic
1025473108 7:60883546-60883568 CACAAAGAACTTTCTGAGAATGG + Intergenic
1025490367 7:61111434-61111456 CACAAAGAAATTTCTGAGAATGG - Intergenic
1025503778 7:61393513-61393535 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025510360 7:61504779-61504801 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025510902 7:61514007-61514029 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1025513897 7:61606320-61606342 CACAAAGAACTTTCTGAGAATGG - Intergenic
1025513959 7:61607694-61607716 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025538241 7:62035160-62035182 CACAAAGAACTTTCTGAGAATGG - Intergenic
1025538303 7:62036534-62036556 CACAATGAAGTTTCTGAGAATGG - Intergenic
1025568789 7:62528363-62528385 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1026381594 7:69805308-69805330 CACAAGGAAATTTCTGGGCAGGG - Intronic
1027725890 7:81805759-81805781 AGAAGGGAAATGACTGAGAAGGG + Intergenic
1028622444 7:92839579-92839601 ATCTTGGAAATGTCTGAGAAGGG - Intergenic
1028746345 7:94331158-94331180 CATATGGATATGTGTGAGAATGG - Intergenic
1029072080 7:97907783-97907805 CACAATGAAATGTCTGTGGATGG + Intergenic
1029604135 7:101588410-101588432 CACAGGGGACTGTCTGGGGAAGG + Intergenic
1031028667 7:116711305-116711327 CACAGGTTAATGACTGAGCAAGG - Intronic
1032090920 7:128911087-128911109 CACATGGAATTGGCTGAGCAGGG - Intergenic
1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG + Intergenic
1035026169 7:155827767-155827789 CACAGGGAAGGGACTGACAAGGG - Intergenic
1035464949 7:159068789-159068811 CCCATGGGAATGTCTCAGAAAGG - Intronic
1036255172 8:7200257-7200279 CACAGTGAAATGTCAGTGGATGG + Intergenic
1037616873 8:20527301-20527323 TACAGGTATATATCTGAGAAAGG + Intergenic
1037906778 8:22720077-22720099 CACAGGGACAGGTGGGAGAAGGG + Intronic
1040272712 8:45973039-45973061 CACAAAGAATTTTCTGAGAATGG - Intergenic
1040996556 8:53408275-53408297 AAGAGGAAAATGTCAGAGAATGG - Intergenic
1041519707 8:58741575-58741597 CTCAGGGAAATGTCTGAAACAGG - Intergenic
1042060985 8:64817516-64817538 GACAGAAAAATGTATGAGAAAGG + Intergenic
1043377400 8:79666289-79666311 CAAAGGGAAATGACTCAGCAGGG - Intergenic
1044115582 8:88329103-88329125 CAGATGGAAAATTCTGAGAATGG + Intergenic
1044433626 8:92136671-92136693 GACAGGGAGATGTCAGGGAAGGG - Intergenic
1044454481 8:92377015-92377037 GACATGGAGATGTTTGAGAATGG + Intergenic
1044502709 8:92978138-92978160 CACAGGGAAAGGTGTCAGACAGG - Intronic
1045177315 8:99739490-99739512 CACAGCCAGATATCTGAGAATGG + Intronic
1045953503 8:107879132-107879154 CACAGGGAAAGGTTTGTGAGAGG + Intergenic
1046182394 8:110668347-110668369 GACATGAAAATTTCTGAGAATGG + Intergenic
1048494239 8:134922130-134922152 CTCAGGGAAATCTCTGAGTCTGG - Intergenic
1048918604 8:139207383-139207405 ATCAGAGAAATGTCTTAGAAAGG + Intergenic
1049192176 8:141294563-141294585 CACAGGGAACTGGCTGTGAGGGG - Intronic
1050510962 9:6395017-6395039 CATAGAAAAATGTCTGAGAAAGG + Intergenic
1050594289 9:7190468-7190490 CACTGGTAACTTTCTGAGAAAGG - Intergenic
1051059330 9:13027880-13027902 CAGATAGAAATGTCTGAGACAGG + Intergenic
1051180161 9:14403397-14403419 AAAAGGGAAATTTCTGGGAAAGG - Intergenic
1051204532 9:14670896-14670918 GAAAGGGAAATGACTAAGAAAGG - Intronic
1052371589 9:27671418-27671440 CACAGGAAGAAGTATGAGAAGGG - Intergenic
1052917775 9:33937225-33937247 CAGAGGGAAAAGTCTGACAAAGG + Intronic
1053222315 9:36322735-36322757 CAGAGGGGAATGACTGTGAATGG - Intergenic
1053714266 9:40868789-40868811 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1054791449 9:69260319-69260341 CTAATGGAAATGTGTGAGAATGG - Intergenic
1056905194 9:90641380-90641402 CACAGGGAAAGGAAGGAGAAAGG - Intronic
1059884971 9:118735830-118735852 TACAGAGAAATGCCTGAGACTGG - Intergenic
1061202706 9:129146804-129146826 AACAGGGGAATGGCTGAGCACGG - Intronic
1061599534 9:131658311-131658333 CACATGGCCATGTCTAAGAAAGG + Intronic
1061741521 9:132709777-132709799 AAGAGGGACATGCCTGAGAAGGG - Intergenic
1062413863 9:136438416-136438438 CACAGGAAAAGTTCTGGGAAGGG + Intronic
1203411602 Un_KI270579v1:14291-14313 CACAAGGAAGTTTCTCAGAATGG + Intergenic
1186307044 X:8273005-8273027 TACATGGAAATGCCTGAGCAGGG + Intergenic
1187664017 X:21583887-21583909 TTCAGGCAAATGTCTGAAAAAGG + Intronic
1188635852 X:32430259-32430281 CACTGTGATATGTCTGAGATTGG + Intronic
1189666865 X:43365162-43365184 CACTGGGAGATGCCTGGGAAGGG - Intergenic
1189733605 X:44047406-44047428 CAAAGTGAAATGGCAGAGAAAGG - Intergenic
1189846844 X:45146135-45146157 CACAGGATAATGACTCAGAAAGG + Intergenic
1190014491 X:46815173-46815195 CCCAGTGAAATGCCTGAGGACGG - Intergenic
1190357521 X:49619475-49619497 CACAGGGAAATCTCGGAGCCTGG - Intergenic
1191566792 X:62547608-62547630 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1191572365 X:62644501-62644523 CACAAAGAAGTTTCTGAGAATGG - Intergenic
1192695209 X:73406560-73406582 AACAGGCAAAGGTCTGACAAAGG + Intergenic
1193475552 X:81960480-81960502 CAAAGTGAAATGTCCCAGAATGG + Intergenic
1195483839 X:105379633-105379655 CACTGGTAAATGTCAGAGCAGGG - Intronic
1196505181 X:116433943-116433965 CACAGGGATATGAATGAGCATGG - Intergenic
1198194217 X:134343733-134343755 CACAGGGAAATATCATAGTATGG - Intergenic
1201064725 Y:10086260-10086282 CACAGAGAAGTTTCTCAGAATGG + Intergenic
1201064761 Y:10086943-10086965 CACAGAGAAGTTTCTCAGAATGG + Intergenic
1201482759 Y:14457794-14457816 CACAGGAAAGTGTCTGATATGGG + Intergenic
1201770911 Y:17615826-17615848 CACACGGACCTGTCTGAGAATGG - Intergenic
1201830644 Y:18290160-18290182 CACACGGACCTGTCTGAGAATGG + Intergenic
1202090198 Y:21180695-21180717 CACACAGAAAAGTCTGAAAAGGG + Intergenic